DOSEN PROFIL LENGKAP

The Year 345 (CCCXLV) was a common year starting on Tuesday of the Julian calendar. At the time, it was known as the Year of the Consulship of Amantius...

Prisoner 345 is a 2006 documentary film. Prisoner 345 is about detained Al Jazeera cameraman Sami Al Hajj, who was detained at the United States detainee...

Class 345 may refer to: British Rail Class 345, electrical multiple unit trains FS Class D.345, Italian diesel-electric locomotives This disambiguation...

The Aermacchi M-345 is a turbofan-powered military trainer aircraft designed and produced by the Italian defense conglomerate Leonardo S.p.A. It is an...

Flight 345 may refer to: Listed chronologically Philippine Air Lines Flight 345, crashed on 28 February 1967 Turkish Airlines Flight 345, crashed on 30...

Interstate 345 (I-345) is an unsigned 1.4-mile-long (2.3 km) Auxiliary Interstate Highway in the city of Dallas within the US state of Texas. It is a freeway...

3C 345 is a blazar, subtype flat-spectrum radio quasar, that is located in the constellation of Hercules. It is noted for hosting a superluminal jet and...

345 FC is a football club from the Cayman Islands that currently competes in the Cayman Islands Premier League. 345 FC was founded in 2017 as the local...

On July 28, 2025, a mass shooting occurred at 345 Park Avenue in Midtown Manhattan, New York City, United States. The incident began at 6:28 p.m. EDT...

Highway 345 (WYO 345) is a 19.27-mile-long (31.01 km) east–west Wyoming State Road located in northern Sheridan County. Wyoming Highway 345 begins its...

International Airport. The landing gear collapsed and two engines broke off. All 345 passengers and 14 crew members were evacuated by inflatable slides, and there...

The Sadid-345, also known simply as the Sadid guided bomb is an Iranian precision-guided glide bomb with a fragmentation warhead. The Sadid-345 is meant...

The Gibson ES-345 is a guitar manufactured by the Gibson Guitar Company. The guitar has been produced since 1959 to the present day. It was designed as...

State Highway 345 (SH 345) is a short spur route from Interstate 69E/U.S. Highway 77/U.S. Highway 83 in San Benito northeast to Rio Hondo in deep southern...

345 Park Avenue is a 634-foot (193 m) skyscraper in the Midtown Manhattan neighborhood of New York City. It occupies an entire city block bounded by Park...

State Road 345 (NM 345) is a 3.6-mile-long (5.8 km) state highway in the US state of New Mexico. NM 345's southern terminus is at Central Avenue in Albuquerque...

State Road 345 (SR 345) is a north–south route in the Big Bend area of Florida, running from U.S. Route 27 Alternate (US 27 Alt.) east of Chiefland to...

The .345 Winchester Self-Loading (.345 WSL / .345 Winchester Machine Rifle) or 8.8x34mm WSL is a rimless, rifle cartridge in a "cylindrical" shape, created...

January 20 is the 20th day of the year in the Gregorian calendar; 345 days remain until the end of the year (346 in leap years). 250 – Pope Fabian is...

Year 345 BC was a year of the pre-Julian Roman calendar. At the time it was known as the Year of the Consulship of Dorsuo and Camerinus (or, less frequently...

Southwest Airlines Flight 345 was a scheduled flight from Nashville International Airport, Tennessee to New York City's LaGuardia Airport. On July 22...

Highway 345 (AR 345, Ark. 345, and Hwy. 345) is a former state highway in Gassville, Arkansas. Added to the state highway system access to industrial...

Highway 345 (AR 345, Ark. 345, and Hwy. 345) is a north–south state highway in Baxter County, Arkansas. The route runs 3.36 miles (5.41 km) between U...

345 California Center is a 48-story office tower in the financial district of San Francisco, California. Completed in 1986, the 211.8 m (695 ft) tower...

The Simca Type 342 and 345 Engines were four-cylinder OHV engines, produced from 1963 through 1975, and used in the Simca mid-size 1501/1301 chassis....

Province in Turkey. The village is populated by Kurds and had a population of 345 in 2022. It formerly had an Armenian population. Köy Archived 6 July 2015...

year in the Gregorian calendar; 344 days remain until the end of the year (345 in leap years). 763 – Following the Battle of Bakhamra between Alids and...

Minuscule 345 (in the Gregory-Aland numbering), ε 119 (Soden), is a Greek minuscule manuscript of the New Testament, on parchment. Paleographically it...

Provincial Road 345 (PR 345) is a west–east provincial road in southwestern Manitoba, Canada. The roadway is 65.6 kilometres (40.8 mi) long. The route...

text related to this article: United States v. Reynolds (345 U.S. 1) United States v. Reynolds, 345 U.S. 1 (1953), is a landmark legal case decided in 1953...

large hydraulic excavator manufactured by Caterpillar Inc. The 345C L, with 345 hp (257 kW) of net flywheel power, is classified as a large excavator by...

The FS Class D.345 is a class of diesel-electric locomotive used in Italy, introduced in the 1970s and still in service. After the positive experience...

township in Martin County, Minnesota, United States. The population was 345 at the 2000 census. East Chain Township took its name from the East Chain...

The Last Full Measure (ISBN 0-345-43481-1 (10 ISBN), ISBN 978-0-345-43481-4 (13 ISBN)) is a 1998 novel by American author Jeffrey Shaara, published on...

The British Rail Class 345 Aventra is a fleet of electric multiple unit passenger trains built by Bombardier Transportation (now Alstom) for use on London's...

345 Tercidina is a large main-belt asteroid. It is classified as a C-type asteroid and is probably composed of carbonaceous material. It was discovered...

Peter M. (1989). Boeing aircraft since 1916 (3rd ed.). London: Putnam. pp. 345–352. ISBN 0851778046. "Boeing/Pratt & Whitney XB-44 factsheet". National...

administrative territory of Zagreb County, Croatia. As of 2011 it had a population of 345 people. Register of spatial units of the State Geodetic Administration of...

48°51′22″N 2°20′42″E / 48.856°N 2.345°E / 48.856; 2.345 The Court of Appeal of Paris (French: Cour d'appel de Paris, [kuʁ dapɛl də paʁi]) is the largest...

Stage IV CTE after he died in 2021, at the age of 74. He was one of at least 345 NFL players to be diagnosed after death with this disease, which is caused...

New York State Route 345 (NY 345) is a state highway located entirely within St. Lawrence County in the North Country of New York in the United States...

The Zhuzhou International Circuit is a 3.774 km (2.345 mi) FIA Grade 2 motorsport circuit in Zhuzhou, China. The circuit was built between March 2018...

Will v. Hallock, 546 U.S. 345 (2006), was a United States Supreme Court case in which the court held that a refusal to apply the Federal Tort Claims Act's...

Mississippi Highway 345 (MS 345) is a 9.272-mile-long (14.922 km) north–south state highway in Pontotoc County, Mississippi, connecting the city of Pontotoc...

time of the filing deadline of May 20, 2016, 682 candidates had filed for 345 offices statewide. Washington had 12 electoral votes for the presidential...

The Scania-Vabis 335/345/355 was a series of heavy duty trucks produced by Swedish automaker Scania-Vabis between 1931 and 1944. In 1931 Scania-Vabis...

China National Highway 345 runs from Qidong in Jiangsu to Nagqu in Tibet. Its exact length is not known yet, as parts of the route are still under planning...

Spur 345 is a 5.1-mile-long (8.2 km) route in Greater San Antonio in the U.S. state of Texas, maintained by the Texas Department of Transportation (TxDOT)...

division of DAF in 1973. The series consisted of the Volvo 340 (previously 343/345) and the later Volvo 360. After building a series of compact cars, DAF sought...

the 2016 census, Mandurama and the surrounding area had a population of 345 people. Mandurama is situated 259 kilometres (161 mi) west of Sydney, 59...

is a village in Ford County, Illinois, United States. The population was 345 at the 2020 census. Roberts was named for the first permanent settlers in...

State Route 345 (SR 345) is a north–south state highway in the eastern portion of the U.S. state of Ohio. The southern terminus of SR 345 is at a signalized...

Wirö are an Indigenous people of Venezuela and eastern Colombia. In 2020, 345 Wirö lived in Venezuela and none lived in cities. The Wirö speak the Wirö...

MTB 345 was an experimental motor torpedo boat constructed in 1941, which saw limited service with the Royal Navy before being transferred to the exiled...

HU-345 (Cannabinolquinone, CBNQ) is a drug that is able to inhibit aortic ring angiogenesis more potently than the parent compound cannabinol (CBN). It...

Athletics at the 1988 Summer Paralympics consisted of 345 events. Because of ties for third place in the men's 800 metre A1–3/A9/L2 and precision throw...

municipality and district of Hınıs, Erzurum Province in Turkey. Its population is 345 (2022). "Hınıs Kaymakamlığı". hinis.gov.tr (in Turkish). Retrieved 30 March...

Goniatitaceae. These fast-moving nektonic carnivores lived in the Carboniferous from 345.3 to 326.4 Ma. Paleontology portal Encyclopedia of life GONIAT The Paleobiology...

10-10-321, 10-10-345, 10-10-220, and 10-10-987 are United States long-distance phone services best known for their prolific television and direct mail...

North Carolina Highway 345 (NC 345) is a primary state highway in the U.S. state of North Carolina connecting Wanchese and Manteo on Roanoke Island. The...

Chitinsky District, Zabaykalsky Krai, Russia. Population: 318 (2021 census); 345 (2010 census); There are 2 streets in this selo. This rural locality is located...

situated in Despotovac municipality in Serbia. As of 2022, the population is 345. Старост и пол: подаци по насељима [Age and sex: Data by settlements] (PDF)...

County in the U.S. state of Texas. As of the 2020 census, the population was 345. In 2009, the city of Keene wanted to annex seven parcels of land to its...

is a village in Texas County, Missouri, United States. The population was 345 at the 2020 census. A post office called Raymondville has been in operation...

Aitalaha was the Bishop of Edessa from 324/5 AD to 345/6 AD. He is also known as Aeithales, Ethilaos, Ethalas, Aithilaha, Aithalas, Aitallaha, Aithalla...

as the I-45 overhead, signed as part of US 75 and also part of unsigned I-345, continues north to the merge with the current end of US 75. Traffic can...

Afranius Syagrius (fl. 345–382) was a Roman politician and administrator. Afranius was a member of the Roman aristocratic family of the Syagrii, which...

Lake Saint Catherine is an 852-acre (345 ha) body of water located in Rutland County, Vermont in the towns of Wells and Poultney. Lake St. Catherine State...

The No. 345 Squadron RAF (GC.II/2) was a French Air Force fighter squadron, serving under Royal Air Force command during the Second World War. The squadron...

Pennsylvania Route 345 (PA 345) is a 13-mile-long (21 km) state highway in the U.S. state of Pennsylvania. The route runs from PA 82 in West Nantmeal...

Province in Turkey. The village is populated by Kurds and had a population of 345 in 2021. It was burned by authorities in 1995, during the Kurdish–Turkish...

University (CLU), with 345 wins and three SCIAC championships, and was also an assistant athletic director. He accumulated a record of 345–207 in his 22 seasons...

Golubac, Serbia. According to the 2002 census, the village has a population of 345 people. Popis stanovništva, domaćinstava i Stanova 2002. Knjiga 1: Nacionalna...

1957 and serves years 9 to 13 (ages 13 to 18). The school has a roll of 345 (March 2026) students. Taita College opened in 1957 to serve the growing...

Handmade Houses had a 12-digit Standard Book Number of 345-24223-8-595 (valid SBN: 345-24223-8, ISBN: 0-345-24223-8), and it cost US$5.95. Since 1 January 2007...

Partners, a privately held global financial services firm with more than $345 billion in assets under management. He is also the CEO and co-chairman of...

The Gibson ES-345 was first produced in 1958 as an upscale version of the ES-335. Although the design is very similar to the 335, the 345 featured a multi-position...

The Type 345 (MR35) fire-control radar system is used to guide the HQ-7 short-range surface-to-air missile. The system is installed on many modern and...

Pakistan inaugurated its new headquarters building in Islamabad, named '345' after Telenor's number dialing prefix '0345'. The new headquarter was built...

between 1773 and 1780, Wolfgang Amadeus Mozart wrote incidental music, K. 345/336a, of an operatic character. The autograph manuscript of the work is preserved...

State Route 345 (SR 345), also known as Cedar Fork Road, is an 8.5-mile-long (13.7 km) north–south state highway in Claiborne County, Tennessee. It serves...

over six years. After his release, al-Hajj wrote a book titled Prisoner 345. He was released without charge on May 1, 2008. He later attempted to launch...

53°20′42″N 1°23′38″W / 53.345°N 1.394°W / 53.345; -1.394 Birley ward — which includes the area of Frecheville, and parts of Gleadless and Hackenthorpe...

township in Grand Forks County, North Dakota, United States. The population was 345 at the 2020 census. The township borders Minnesota to its east. Ferry Township...

with five digits: 2469 / 200 = 12.345 = 12345 ⏟ significand × 10 ⏟ base − 3 ⏞ exponent {\displaystyle 2469/200=12.345=\!\underbrace {12345} _{\text{significand}}\...

DeKalb County, Illinois, USA. As of the 2020 census, its population was 345 and it contained 130 housing units. According to the 2021 census gazetteer...

Kolonigué Commune in Sikasso Region, Mali. It has an average elevation of 345 metres above the sea level. Molobala has Semi-arid Climate (BSh) under the...

to 1982. In October 1982, she was sold to Turkey and renamed Yücetepe (D 345). After her final decommissioning, the Turkish government transferred Yücetepe...

denied to obey and was sentenced to death by the mayor of the village in 345. Abda and Abdjesus The Roman Eastern Frontier and the Persian Wars (AD 226-363):...

Turkey. It is populated by Kurds of the Herdî tribe had a population of 345 in 2025. Mahalle Archived 6 July 2015 at the Wayback Machine, Turkey Civil...

Belgium. Built between 2015 and 2019, the tower stands at 105.2 metres (345 ft) tall with 25 floors and is the twelfth tallest building in Belgium. The...

Turkish Airlines Flight 345 was a scheduled domestic passenger flight operated by a Fokker F28-1000 Fellowship from İzmir Cumaovası Airport to Istanbul...

A Call to Arms (1991) ISBN 0-345-35855-4 The False Mirror (1992) ISBN 0-345-35856-2 The Spoils of War (1993) ISBN 0-345-35857-0 Dinotopia Lost (1996)...

In molecular biology mir-345 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms...

that travels from I-345 in Dallas, Texas northward to the Canadian border in Noyes, Minnesota. In the state of Texas it runs from I-345 in Dallas and heads...

USS Cochino (SS-345) was a Balao-class submarine in service with the United States Navy from 1945 to 1949. She sank after a battery explosion off Norway...

USS Aurora (SP-345) was a harbor tug and a minesweeper of the United States Navy. Built in 1906 in Camden, New Jersey, by John H. Dialogue, the Aurora...

in the Çankırı District of Çankırı Province in Turkey. Its population is 345 (2021). Köy, Turkey Civil Administration Departments Inventory. Retrieved...

Hickory Corners Masonic Temple, also known as Hickory Lodge No. 345 is a Masonic Temple located at 4558 West Hickory Road in Hickory Corners, Michigan...

kingdom. He was defeated by the emperor Mahapadma Nanda of Magadha in 362 or 345 BCE. However, he was not killed, and fled to Rohtas, located in present-day...

township in Clearwater County, Minnesota, United States. The population was 345 at the 2000 census. Leon Township was organized in 1897. The township was...

USS Robert Brazier (DE-345) was a John C. Butler-class destroyer escort in service with the United States Navy from 1944 to 1946. She was sunk as a target...

located in White County, Illinois. As of the 2010 census, its population was 345 and it contained 195 housing units. According to the 2010 census, the township...

the international border between Cambodia and Laos. The border is 555 km (345 mi) in length and runs from the tripoint with Thailand in the west to the...

County, Kansas, United States. As of the 2020 census, its population was 345. Historically the Garfield Township was organized as Garfield County in 1887...

also known as Karl's Shoes, is a historic two-story building located at 341-345 S. Broadway in the Broadway Theater District in the historic core of downtown...

Kentucky, United States. As of the 2020 census, Ages had a population of 345. A post office called "Ages" was established in 1892, and the post office...

W-345 is a reserved Constituency for female in the Provincial Assembly of Punjab. Punjab portal Pakistan portal Punjab, Pakistan "Punjab Assembly | Members...

Anglesey, Wales, which is 130.7 miles (210.3 km) from Cardiff and 214.6 miles (345.3 km) from London.[citation needed] "Henblas, Anglesey". Gazetteer of British...

a township in Pine County, Minnesota, United States. The population was 345 at the 2000 census. Arlone Township was organized in 1911, and named for...

numbered 345: - Victoria Manitoba Provincial Road 345 New Brunswick Route 345 Newfoundland and Labrador Route 345 Prince Edward Island Route 345 Quebec...

the United States. As of the 2020 census, Grand Rivers had a population of 345. It is part of the Paducah, KY-IL Metropolitan Statistical Area. According...

Archetype by Clarissa Pinkola Estes, Author Ballantine $27.95 (560p) ISBN 978-0-345-37744-9". PublishersWeekly.com. Estés, Clarissa Pinkola. (1992). Women who...

Terry v. Adams, 345 U.S. 461 (1953), was a United States Supreme Court decision that held white-only pre-primary elections to be unconstitutional. It...

6 September 1946) is a Scottish former professional footballer, who made 345 appearances in the Scottish League and Football League playing mainly as...

Arkansas, United States. As of the 2020 census, Hatfield had a population of 345. Hatfield is located at 34°29′13″N 94°22′42″W / 34.48694°N 94.37833°W...

Times-Picayune Publishing Co. v. United States, 345 U.S. 594 (1953), is an antitrust law decision by the United States Supreme Court. In a 5–4 decision...

(a selo) in Shamilsky District, Republic of Dagestan, Russia. Population: 345 (2021 census); 302 (2002 census); 154 (1989 Soviet census). There is 1 street...

of June 2026, Wikipedia articles have been created in 361 editions, with 345 currently active, 16 closed and 11 moved to Wikimedia Incubator. The Meta-Wiki...

Area code 345 is the telephone area code in the North American Numbering Plan (NANP) for the Cayman Islands. The area code was created in a split of numbering...

command of Commander Task Force (CTF) 311 (UK attack submarines) and CTF 345 (UK nuclear missile submarines). Maritime Reservists from HMS Wildfire, part...

43) was an Act of the New Zealand Parliament. It was repealed by section 345(1)(a) of the Contract and Commercial Law Act 2017. The Carriage of Goods...

seasons in the National Football League (NFL). Welch is one of at least 345 NFL players to be diagnosed after death with chronic traumatic encephalopathy...

volume 345 of the United States Reports: Supreme Court of the United States (www.supremecourt.gov) United States Supreme Court cases in volume 345 (Open...

County in northern-central Lithuania. As of 2011 it had a population of 345. "2011 census". Statistikos Departamentas (Lithuania). Retrieved August 13...

The Schenkenberg is a hill in the 19th district of Vienna, Döbling. It is 345 metres tall. The Schenkenberg lies in Obersievering and represents the south-eastern...

point in the state of Florida, United States, with a summit elevation of 345 ft (105 m) above mean sea level. Britton Hill is the lowest state highpoint...

of Dolan Springs. As of the 2020 census, White Hills had a population of 345. In 1892, Henry Shaffer discovered silver deposits in the area, with the...

whose population at the time of the 2016 National Census was 1,046 people in 345 households. In 2023, Bam and Safiabad District was separated from Esfarayen...

Maharashtra, India. The university, with a campus spread over 853 acres (345 ha), is named in honour of Chatrapati Shivaji. It was inaugurated on 18 November...

of Stateira I and Darius III of Persia. Drypetis was born between 350 and 345 BCE, and, along with her sister Stateira II, was a princess of the Achaemenid...

Menlo is a city in Guthrie County, Iowa, United States. The population was 345 at the time of the 2020 census. It is part of the Des Moines metropolitan...

ISBN 0-345-33605-4. Estes, Rose (June 1984). Indiana Jones and the Lost Treasure of Sheba. Illustrated by David B. Mattingly. Ballantine. ISBN 0-345-31664-9...

The Hudson Project is a 345 kV AC underground and submarine power cable system which supplies electric power to New York City from the Bergen Generating...

Lacona is a city in Warren County, Iowa, United States. The population was 345 at the time of the 2020 census. It is part of the Des Moines metropolitan...

bomber with a range of 2,000 miles (3,200 km). Boeing submitted its Model 345 on 11 May 1940, in competition with designs from Consolidated Aircraft (the...

The Rickman House is an apartment building located at 345 North Burdick in Kalamazoo, Michigan. It was formerly a hotel known as the Rickman Hotel. It...

Expression of Sympathy". Dáil Debates. 345 (1). 19 October 1983. "Issue of Writ: Dublin Central By-Election". Dáil Debates. 345 (6). 2 November 1983. "Return to...

Ford Motor Co. v. Huffman, 345 U.S. 330 (1953) is a U.S. Supreme Court Case that dealt with whether a seniority policy that credited veterans for military...

Fulton County, Illinois, USA. As of the 2020 census, its population was 345 and it contained 174 housing units. According to the 2021 census gazetteer...

Linn County, Missouri. The population was 305 at the 2020 census, down from 345 in 2010. Laclede was platted in 1853. The city was named for Pierre Laclède...

station is a station on Konkan Railway. It is at a distance of 556.032 km (345.5 mi) down from origin. The preceding station on the line is Gokarna Road...

West (ISBN 0-345-35266-1) King of the Murgos (ISBN 0-345-35880-5) Demon Lord of Karanda (ISBN 0-345-36331-0) Sorceress of Darshiva (ISBN 0-345-36935-1) The...

school in the Bethel Local School district. The student enrollment is about 345, in grades 9–12. Their nickname is the Bees. Originally the school was known...

(also, Shamly) is a village and municipality in the Qabala Rayon of Azerbaijan. It has a population of 345. Şamlı, Qabala at GEOnet Names Server v t e...

Christian County, Illinois, USA. As of the 2020 census, its population was 345 and it contained 162 housing units. According to the 2010 census, the township...

or other symbols instead of Braille characters. The Braille pattern dots-345 ( ⠜ ) is a 6-dot braille cell with the top and middle right and bottom left...

United States. The island has a land area of 1.398 km2 (0.540 sq mi) or 345.5 acres) and was uninhabited as of the 2000 census. The island is part of...

Caught Dead in Philadelphia (ISBN 978-0-345-35340-5) is a book written by Gillian Roberts and published by Scribner Press - now owned by Simon & Schuster...

ISBN 978-0-345-50108-0. Greenberger, Robert; Pasko, Martin (2010). The Essential Superman Encyclopedia. Del Rey. pp. 84–85. ISBN 978-0-345-50108-0. Byrne...

ISBN 0-345-42452-2) Babylon 5: Thirdspace, by Peter David (1998, ISBN 0-345-42454-9) Babylon 5: A Call to Arms, by Robert Sheckley (1999, ISBN 0-345-43155-3)...

silent comedy trick film, directed by Georges Méliès. It is listed as numbers 345–347 in Star Film Company's catalogues. A man enters his "cavern," and uses...

The Rural Municipality of Vanscoy No. 345 (2016 population: 2,840) is a rural municipality (RM) in the Canadian province of Saskatchewan within Census...

and district of Manavgat, Antalya Province, Turkey. total population is 345 (2022). Mahalle, Turkey Civil Administration Departments Inventory. Retrieved...

Tosite Sigure was formed in 2002 in Saitama, Japan. TK (vocals, guitar) and 345 (vocals, bass) started first with NodaMEN (drums) then Pierre Nakano (drums)...

related to this article: Poulos v. New Hampshire Poulos v. New Hampshire, 345 U.S. 395 (1953), was a case in which the Supreme Court of the United States...

Valens, a top 40 hit on the U.S. charts. Valens's version is ranked number 345 on Rolling Stone magazine's list of "The 500 Greatest Songs of All Time"...

Philippine Air Lines Flight 345 was a domestic flight operated by Philippine Air Lines that crashed on approach to Mactan–Cebu International Airport,...

is 12.6 km (7.8 mi) in diameter and its age is estimated to be less than 345 million years (Carboniferous or younger). An outer and an inner ring (11...

state of Former Yan against the Yuwen tribe in February or March 344 (or 345). It was the penultimate campaign in Murong Huang's conquests in the northeast...

According to the 2006 census (INE), the municipality has a population of 345 inhabitants. List of municipalities in Cáceres National Statistics Institute...

70,391. The highest point of Belarus is situated in the district. It is 345 meters above level sea and called Dzyarzhynskaya Hara. Dzyarzhynsk Fanipal...

viaduct was granted by Buckinghamshire Council in April 2023. The viaduct is 345 metres (1,132 feet) long and will pass over the A413 road which will be realigned...

42°20′42″N 91°14′35″W / 42.345°N 91.243°W / 42.345; -91.243 The Delaware County Historical Museum Complex is an open-air museum of nine buildings located...

Pirot, Serbia. According to the 2002 census, the village has a population of 345 people. Popis stanovništva, domaćinstava i Stanova 2002. Knjiga 1: Nacionalna...

Gordo County, Iowa, United States. As of the 2000 census, its population was 345. Lake Township covers an area of 26.76 square miles (69.3 km2) and contains...

200 ly (20.91 kpc) (estimated) Apparent size (V) 7.2′ × 6.3′ Other designations ESO 576- G 029, IRAS 13161-2046, UGCA 345, MCG -03-34-046, PGC 46400...

of São Paulo, Brazil. The population is 12,485 (2020 est.) in an area of 345.6 km2 (133.4 sq mi). Tabapuã belongs to the Mesoregion of São José do Rio...

Ríagal) was a legendary 4th century monk or bishop of Patras, Greece who in AD 345 is said to have fled to Scotland with the bones of Saint Andrew, and deposited...

International Labour Organization. Đurović, Branka. "The World Day for Safety and Health at Work." Vojnosanitetski pregled 70.4 (2013): 343-345.Link...

village is inhabited by Kurds of the Delikan tribe and had a population of 345 in 2022. In late 19th century, the village was a settlement with 5 houses...

F. 1922c. Myrmicines, dolichodérines et autres formicides néotropiques. Bull. Soc. Vaudoise Sci. Nat. 54: 345-378 (page 371, worker described) v t e...

(born 7 May 1996) is a Caymanian footballer who plays as a midfielder for 345 and the Cayman Islands national team. Ebanks debuted for the Cayman Islands...

USS YP-345 was a converted fishing vessel which served in the U.S. Navy during World War II. YP-345 was commissioned by the Van Camp Sea Food Co. Inc....

detection of a seaborgium carbonyl complex". Science. 345 (6203): 1491–3. Bibcode:2014Sci...345.1491E. doi:10.1126/science.1255720. PMID 25237098. S2CID 206558746...

Tarragona and autonomous community of Catalonia, Spain. It has a population of 345 (register office, 2025) . "Ajuntament de Poboleda". Generalitat of Catalonia...

Inanimate Objects and the Uncanny Valley. In: Minds and Machines 19 (2009), 345-59. doi:10.1007/S11023-009-9158-2. Gibt es eine ästhetische Emotion? In:...

Moist Mixed Grassland ecoregion in the Rural Municipality of Vanscoy No. 345, about 30 kilometres (19 mi) west of Saskatoon. There are no communities...

pickups), cylinder deactivation is not included. The 5.7 L (345 cu in) Hemi in the Ram delivered 345 hp (257 kW) and 375 lb⋅ft (508 N⋅m), but 340 hp (254 kW)...

Saujana Rawang is a township in Gombak District, Selangor, Malaysia. It is a 345 acres (140 ha) self-contained township development by Glomac Berhad that...

Del Rey Books. ISBN 978-0-345-43541-5. Luceno, James (2001). Cloak of Deception. New York City: Del Rey Books. ISBN 978-0-345-44297-0. John Ostrander (w)...

Route 345 is a provincial highway located in the Lanaudière region of Quebec. It runs from the junction of Route 158 in Sainte-Geneviève-de-Berthier and...

Diyarbakır Province in Turkey. It is populated by Kurds and had a population of 345 in 2022. "Mahalli İdareler" (in Turkish). Lice Kaymakamlığı. Retrieved 29...

Swimming at the 1984 Summer Paralympics consisted of 345 events.  Australia (29)  Austria (4)  Belgium (3)  Brazil (5)  Canada (53)  China (15)  Denmark (15)...

Western Europe and the largest on the course of the Rhône. Sixty percent (345.31 km2 or 133.32 sq mi) of the lake belongs to Switzerland (the cantons of...

MeSH D04.345.241.308 – crown ethers MeSH D04.345.295.500 – maytansine MeSH D04.345.295.750 – rifamycins MeSH D04.345.295.750.650 – rifabutin MeSH D04.345.295...

The Gotha Go 345 was a prototype German military transport glider of the Second World War. A single example was tested in 1944. Go 345A The assault transport...

competed in two events at the 1912 Summer Olympics. In 1911 he won the Danish 345 km long-distance classic Sjælland Rundt. "Valdemar Nielsen". CyclingRanking...

The Tides of Time (ISBN 0-345-31838-2) is a science fiction novel by John Brunner. It was first published in the United States by Ballantine Del Rey Books...

1999. Retrieved April 18, 2021. "Top 10". The Hollywood Reporter. Vol. 345, no. 1. November 20, 1996. p. 25. ProQuest 2469228989. "Top Ranked Programs...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1692. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1697. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1685. ISBN 978-0-345-49773-4....

National Route 345 is a national highway of Japan connecting Chūō-ku, Niigata and Yuza, Yamagata in Japan, with a total length of 212.0 kilometers (131...

Dictionary of American Family Names. New York: Oxford University Press. p. 345. This page lists people with the surname Sidebotham. If an internal link...

in northern Sheridan County that connects U.S. Route 14 (US 14) and WYO 345. Wyoming Highway 343 begins its southern end at U.S. Route 14 at Dayton and...

the 2006 census, its population was 224, in 83 families. Decreased from 345 people in 2006. Kaldeh at GEOnet Names Server Census of the Islamic Republic...

in 1989, it is part of Toronto-based Four Seasons Hotels and Resorts. The 345-room hotel occupies the 30th through 46th floors of the 900 North Michigan...

Rufinus, also called Rufinus of Aquileia (Latin: Rufinus Aquileiensis; 344/345–411), was an early Christian monk, philosopher, historian, and theologian...

USS LST-345 was a LST-1-class tank landing ship of the United States Navy during World War II. LST-345 was laid down on 17 October 1942 at the Norfolk...

The Rural Municipality of Fish Creek No. 402 (2016 population: 345) is a rural municipality (RM) in the Canadian province of Saskatchewan within Census...

G. J. (2013). The Borgias: The Hidden History. Bantam Books. ISBN 978-0-345-52691-5. Strathern, Paul (29 September 2009). The Artist, the Philosopher...

and Cable TV Shows 1946-Present. Ballantine Books. 2003. p. 1433. ISBN 0-345-45542-8. "What you didn't know about One Day At A Time,"TV Land, 25 April...

located on the banks of the Fluessen [nl] and had a population of around 345 in 2017. The village was first mentioned in 1412 as Elahuysen, and means...

Arsanjan County, Fars province, Iran. At the 2006 census, its population was 345, in 77 families. Kafr at GEOnet Names Server "Census of the Islamic Republic...

the Journal Citation Reports, the journal has a 2021 impact factor of 2.345. "Journal of Organometallic Chemistry". 2021 Journal Citation Reports. Web...

Tennessee and Kentucky. They date back to the Lower Mississippian, about 345 million years ago. One of the locations from which Agaricocrinus americanus...

071112_SLXA-EAS1_s_7:5:1:817:345 length=36 GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36...

BCE), Indian dynasty started by Gonanda III Gonanda dynasty (II) (c. 25 – 345 CE), Indian dynasty started by Meghavahana This set index article includes...

personnel are non-partisan public servants. Colorado employs a total of 345 legislative staff across various functions. NCSL classifies Colorado's legislative...

30, east of Austin Street, north of Corinth Street, and west of the 75 & 345 Overpasses just east of South Good Latimer Expy. The Cedars was originally...

Jackson v. Metropolitan Edison Co., 419 U.S. 345 (1974), is an administrative law case of the Supreme Court of the United States holding that extensive...

near Șomănești. Its length is 42 km (26 mi) and its basin size is 894 km2 (345 sq mi). The 4 km long reach of the river, upstream of the Tismana Monastery...

ISBN 978-0-345-53044-8 Sneaky Pie for President (2012) ISBN 1410450244/ISBN 0345530470 — Not a Mrs. Murphy mystery The Litter of the Law (2013) ISBN 978-0-345-53048-6...

dead soldier into an android with superhuman strength, codenamed Subject 345. William specializes in synthetic biology and mapping of the mind's neural...

Abraham of Arbela (died c. 345) (also known as Abramius) was a bishop of Arbela in Sassanid Persia. During the imprisonment of Bishop Ioannis of Arbela...

State Highway 336 (SH 336) is a 14.506-mile (23.345 km) state highway in the U.S. state of Texas. The highway begins at a junction with Spur 241 in Hidalgo...

Broadway was at the Selwyn Theatre on 28 December 1927, where it ran for 345 performances to close in October 1928. It was included in Burns Mantle's...

communities on Mt Oku (Cameroon volcanic line)" (PDF). Comptes Rendus Geoscience. 345 (7–8): 316–326. doi:10.1016/j.crte.2013.08.001. ISSN 1631-0713. v t e...

Severo-Baykalsky District, Republic of Buryatia, Russia. The population was 345 as of 2010. Kholodnaya is located 77 km east of Nizhneangarsk (the district's...

Holdings, the brand was purchased in 2011 by Mood Media in a deal worth US$345 million. In the United States, due in part to the market dominance of Muzak...

1980 (ISBN 0-345-28367-8) Twilight at the Well of Souls, Del Rey, 1980 (ISBN 0-345-28368-6) The Sea Is Full of Stars, December 1999 (ISBN 0-345-39486-0) Ghost...

district of Karpuzlu, Aydın Province, Turkey. In 2022, the population was 345. Mahalle Archived 2015-07-06 at the Wayback Machine, Turkey Civil Administration...

Jalan Hospital Serdang, Federal Route 345, is an institutional facilities federal road in Selangor, Malaysia. It is a main route to Serdang Hospital from...

(48 mi) east of the city of Salto. In 2011 Biassini had a population of 345. Source: Instituto Nacional de Estadística de Uruguay "Censos 2011 Salto...

Network and Cable TV Shows 1946–Present (9 ed.). New York: Ballantine Books. p. 196. ISBN 978-0-345-49773-4. Retrieved July 24, 2024. Built to Last at IMDb...

 1325. ISBN 0-345-45542-8. Schemering, Christopher (1987). The Soap Opera Encyclopedia (2nd ed.). Ballantine Books. p. 240. ISBN 0-345-35344-7. The World...

entered the 100 Crore Club in India within six days of release. Earning ₹345 crore (US$36 million) worldwide, Drishyam 2 emerged as a major commercial...

in area, and is traversed by the Kabul River. It has a mean elevation of 345 metres (1,132 ft). It is heavily populated. The five most populous cities...

Anusara's founder John Friend. He is widely known for his appearance in 345 yoga asanas in Anusara's 2004 poster Penchant for Practice. He has been praised...

(ISBN 0-9658345-0-6, 1997) Brill and Maxwell The Dopplegänger Gambit (ISBN 0-345-28267-1, 1979) Spider Play (ISBN 0-445-20273-4, 1986) Dragon's Teeth (ISBN 0-445-20906-2...

time of the 1991 Nepal census it had a population of 1734 people living in 345 individual households. "Nepal Census 2001". Nepal's Village Development Committees...

The Complete Directory to Prime Time Network and Cable TV Shows, 1946-Present. Ballantine Books. 2003. p. 179. ISBN 0-345-45542-8. David Berman at IMDb...

hara, [dzʲarˈʐɨnskaja]) is the highest point in Belarus. The hill is 345 meters (1,130 ft) above sea level and is located west of the capital Minsk...

SP-345 is a state highway in the state of São Paulo in Brazil. "Pesquisa de Rodovias". DER/SP. Retrieved 2023-03-10. v t e...

who fights in the light heavyweight division. Gonzalez amassed a record of 345–27 while fighting for the Cuban amateur team before moving to Miami in 2010...

Şirvan District of Siirt Province in Turkey. The village had a population of 345 in 2021. "31 ARALIK 2021 TARİHLİ ADRESE DAYALI NÜFUS KAYIT SİSTEMİ (ADNKS)...

Yangtze River in Chongqing, China. Completed in 2008, it has a main span of 345 metres (1,132 ft). The bridge carries road of traffic between the Jiangjin...

120 kg (260 lb), he has been Champion of Krasnoyarsk Region in deadlift (345 kg). In 2012 he participated in World Sub-Juniors and Juniors Powerlifting...

fr. 132 [=Fowler (2013), vol. 1, p. 345 & vol. 2, p. 438] Pherecydes, fr. 132 [=Fowler (2013), vol. 1, p. 345 & vol. 2, p. 438] listed the three siblings...

and Cable TV Shows 1946-Present. Ballantine Books. 2003. p. 1117. ISBN 0-345-45542-8. "Robin Coleman - IMDb". IMDb. Retrieved September 6, 2017. Star...

Comprehensive Guide to the Origins of Geographic Names : a Compilation. Salt Lake City: University of Utah Press. p. 99. ISBN 978-0-87480-345-7. v t e...

TV Shows, 1946-Present. New York: Ballantine Books. p. 1154. ISBN 978-0-345-49773-4. McNeil, Alex (1996). Total Television: the Comprehensive Guide to...

Kentucky Route 105 (KY 105) is an 18.345-mile-long (29.523 km) state highway in Breckinridge County, Kentucky. It travels from KY 79 and KY 2201 just...

German submarine U-345 was a Type VIIC U-boat of Nazi Germany's Kriegsmarine during World War II. She carried out no patrols. She did not sink or damage...

Cable TV Shows, 1946-Present (9 ed.). Ballantine Books. p. 781. ISBN 978-0-345-49773-4. Mansour, David (2005). From Abba to Zoom: A Pop Culture Encyclopedia...

listed on the São Paulo Stock Exchange where it raised 603 million reais ($345 million) in an initial public offering in 2007. In 2008, the company was...

municipality and district of Ayaş, Ankara Province, Turkey. Its population is 345 (2022). Çanıllı was an independent municipality until it was merged into...

vessel displaced 5,773 tonnes (5,682 long tons) and measured 105.2 metres (345 ft) long with a beam of 14.5 metres (48 ft). High running costs led to the...

suspension feeders lived in the Carboniferous period of United States, from 345.0 to 342.8 Ma. Dizygocrinus biturbinatus (Hall) Dizygocrinus indianaensis...

mother was Nana of Iberia. Professor Cyril Toumanoff suggests the years 345–361 as the period of their joint reign. According to the medieval Georgian...

Lok Sabha constituency. Since 2008, this assembly constituency is numbered 345 amongst 403 constituencies. Bahujan Samaj Party member Bandana Singh served...

service, the aircraft is intended to be replaced by the newer Aermacchi M-345. During September 1972, Aermacchi was awarded a contract to study a replacement...

Bolu District, Bolu Province, Turkey. As of 2021, it had a population of 345 people. Köy, Turkey Civil Administration Departments Inventory. Retrieved...

MyFitnessPal would be sold to the private equity firm Francisco Partners for $345 million and that it was shutting down Endomondo. In 2021, MyFitnessPal partnered...

Implementing IPv6 in Mobile and Fixed Networks. John Wiley and Sons. pp. 345–350. ISBN 9780470468906. Stockebrand, Benedikt (28 November 2006). IPv6 in...

The Complete Directory to Prime Time Network and Cable TV Shows, 1946–Present. Ballantine Books. p. 553. ISBN 0-345-45542-8. Hot Shots at IMDb v t e...

Time Network and Cable TV Shows 1946-Present. Ballantine Books. ISBN 978-0-345-49773-4. Retrieved July 23, 2024. p. 175. D'Arc, James V. (2010). When Hollywood...

United States v. Kahriger, 345 U.S. 22 (1953), was a United States Supreme Court ruling that held certain provisions of the Revenue Act of 1951 were constitutional...

transferred to the Turkish Navy and recommissioned the same day as TCG Giresun (D 345). Giresun was stricken and scrapped in 1973. DANFS says 197; but the article...

the 3rd Gebirgsjäger Division on the Eastern Front of World War II. With 345 confirmed kills, he was the most successful German sniper and one of the...

Tales (ISBN 0-345-33661-5) Tales of the Cthulhu Mythos (ISBN 0-345-42204-X) The Doom That Came to Sarnath and Other Stories (ISBN 0-345-33105-2) The Lurking...

ISBN 0-345-34138-4 No. 6 Doomsday (1987), ISBN 0-345-34139-2 No. 7 Southern Cross (1987), ISBN 0-345-34140-6 No. 8 Metal Fire (1987), ISBN 0-345-34141-4...

Oakland University where he broke the school record with 137 games played and 345 offensive rebounds. Hudson attended Middleton High School in Middleton, Wisconsin...

Tavas, Denizli Province in Turkey. As of the 2022 census, its population is 345. "Mahalli İdareler" (in Turkish). Tavas Kaymakamlığı. Retrieved 24 August...

Firenze e de' suoi contorni, Presso Guglielmo Piatti, Florence (1841), page 345. 43°46′2.99″N 11°15′32.75″E / 43.7674972°N 11.2590972°E / 43.7674972;...

and the Macabre (1st ed.). New York: Ballantine Publishing Group. ISBN 0-345-35080-4. Price, Robert M. (1990). H. P. Lovecraft and the Cthulhu Mythos...

ISBN 0-345-24825-2 (Mass Market) Random House Publishing Group, 1980, ISBN 0-345-29238-3 (Mass Market) Random House Publishing Group, 1981, ISBN 0-345-30113-7...

Shows 1946-Present (Ninth ed.). Ballantine Books. pp. 1683–1685. ISBN 978-0-345-49773-4. Tied with Bewitched Tied with Daktari and Bewitched "The Beverly...

with Runway 1 length of 3937 feet. The airport has a field elevation of 345 feet and a magnetic variation of 10.286°W it is a regional airport that has...

Earle (2007). The Complete Directory to Primetime Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1679. ISBN 978-0-345-49773-4....

Shows 1946–Present (9 ed.). New York: Ballantine Books. p. 382. ISBN 978-0-345-49773-4. Retrieved March 6, 2026. Tim Brooks and Earle Marsh, The Complete...

and a Classification of South American Tayassuids". Journal of Mammalian Evolution. 24 (3): 345–358. doi:10.1007/s10914-016-9347-8. hdl:11336/54840....

Selsoviet of Belogorsky District, Amur Oblast, Russia. The population was 345 as of 2018. There are 8 streets. Mezhdugranka is located near the left bank...

NGC 345 is a spiral galaxy located in the constellation Cetus. It was discovered on September 27, 1864 by Albert Marth. It was described by Dreyer as...

2004, ISBN 0-345-46477-X; sc, 288 pages, 2005, ISBN 0-345-46478-8) Six Bad Things (sc, 305 pages, Ballantine Books, 2005, ISBN 0-345-46479-6) A Dangerous...

(ISBN 0-345-33172-9) Revenge of the Damned (1989) (ISBN 0-345-33173-7) The Return of the Emperor (1990) (ISBN 0-345-36130-X) Vortex (1992) (ISBN 0-345-37151-8)...

Retrieved June 24, 2021. "Primetime TV Rate Race". The Hollywood Reporter. Vol. 345, no. 1. November 6, 1996. pp. 24–25. ProQuest 2469228989. "Top Ranked Programs...

From the time of her construction in 1960 until the construction of the 345 m (1,132 ft) RMS Queen Mary 2 in 2004, the 316 m (1,037 ft) vessel was the...

winner of the World Cup slalom discipline title. Shiffrin, at 18 years and 345 days, became the youngest slalom gold medalist in Olympic history in 2014...

The Wong K. Gew Mansion is a historic house located at 345 W. Clay St. in Stockton. The mansion was the home of Wong K. Gew, a Chinese immigrant and a...

northern Luxembourg. As of 2025[update], the village has a population of 345. It was the site of intense fighting between German and American troops in...

The Patrick Murphy House is a historic house at 345 Palisado Avenue in Windsor, Connecticut, United States. Built about 1873, it is a good example of...

White Castle is an American regional hamburger restaurant chain with about 345 locations across 13 states, with its greatest presence in the Midwest and...

in Kyakhtinsky District, Republic of Buryatia, Russia. The population was 345 as of 2010. There are 8 streets. Oktyabrsky is located 63 km southeast of...

Language Study Vol 1: Papuan Languages and the New Guinea linguistic scene, 345-460. Canberra: Research School of Pacific and Asian Studies, Australian National...

and March 7, 1950. ESPN College Basketball Encyclopedia: The Complete History of the Men's Game. Random House. 2009. p. 595. ISBN 978-0-345-51392-2....

Al-Fuhaid held the record for most appearances in the Saudi Pro League with 345 appearances, until it was surpassed by Yahya Al-Shehri in 2026. On 21 September...

ISBN 978-0-345-44124-9 Dragon's Fire (2006) (Anne & Todd McCaffrey) ISBN 978-0-345-48028-6 Dragon Harper (2007) (Anne & Todd McCaffrey) ISBN 978-0-345-48030-9...

played for the USC Trojans and the Minnesota Vikings. He is one of at least 345 NFL players to be diagnosed after death with chronic traumatic encephalopathy...

Selsoviet, Yanaulsky District, Bashkortostan, Russia. The population was 345 as of 2010. There are 6 streets. Salikhovo is located 43 km southeast of...

In Yarshater, Ehsan (ed.). Encyclopædia Iranica. 4. Vol. VIII. New York City: Bibliotheca Persica Press. pp. 345–355. Retrieved March 15, 2016. v t e...

and Cable TV Shows 1946-Present. Ballantine Books. 2003. p. 676. ISBN 0-345-45542-8. "1983-84 Ratings History -- The Networks Are Awash in a Bubble Bath...

Cable TV Shows 1946–Present (9 ed.). New York: Ballantine Books. p. 948. ISBN 978-0-345-49773-4. Retrieved April 4, 2026. My Wildest Dreams at IMDb v t e...

Night". The Soap Opera Encyclopedia. Ballantine Books. pp. 85–92. ISBN 0-345-32459-5. Waggett, Gerard J. (November 1997). "The Edge of Night". The Soap...

ISBN 978-0-345-44360-1 Mistral's Kiss (2006) ISBN 978-0-345-44361-8 A Lick of Frost (2007) ISBN 978-0-345-49591-4 Swallowing Darkness (2008) ISBN 978-0-345-49593-8...

It is designed for longitudinal engine applications and can handle up to 345 lb⋅ft (468 N⋅m) of torque. General Motors used the AY-6 as RPO MV1, MV5,...

Ballantine Books. ISBN 978-0-345-35375-7. James Kahn (May 1984). Indiana Jones and the Temple of Doom. Ballantine Books. ISBN 978-0-345-31457-4. Rob MacGregor...

Society. Marcellus of Ancyra and the lost years of the Arian controversy, 325–345, Oxford: Oxford University Press, 2006. Justin Martyr and His Worlds, with...

Lecithocera Herrich-Schaffer, 1853 and descriptions of new species (Lepidoptera: Lecithoceridae)" (PDF). Sinozoologia (in Chinese). 10: 319–345. v t e...

municipality of Kungsbacka in the county of Halland. It covers an area of 345 hectares. In 2000, it had 3,541 inhabitants. The village has been used as...

Kannada district in India. The kingdom was founded by Mayurasharma in c. 345, and at later times showed the potential of developing into imperial proportions...

Anglesey, Wales, which is 130.3 miles (209.7 km) from Cardiff and 214.6 miles (345.4 km) from London. The chapel of the same name (Capel Mawr) was built in...

Complete Directory to Prime Time Network and Cable TV Shows, 1946-Present. Ballantine Books. 2003. p. 1103. ISBN 0-345-45542-8. South Beach at IMDb v t e...

Christians, was killed under the Persian ruler Shapur II on Good Friday, 345. One of these others was also named Abdecalas. Simeon, bishop of Seleucia...

Cable TV Shows (9th ed.). New York, NY: Ballantine Books. p. 406. ISBN 978-0-345-49773-4. Brooks, Tim; Earle, Marsh (2007). The Complete Directory to Prime...

in 1884. In his seventeen first-class matches for the county, he scored 345 runs at an average of 11.12, with a high score of 54. This score was his...

County, Missouri, United States. At the 2020 census, its population was 345. Wilson Township bears the name of an early settler. The following highways...

The fourth USS Preble (DD-345/DM-20/AG-99) was a United States Navy Clemson-class destroyer in commission from 1920 to 1945. She served in China, including...

Gregory of Cappadocia served as Patriarch of Alexandria between 339 and 345. The appointment was made due to political pressure on Emperor Constantius...

of New Jersey. As of the 2020 census, Dividing Creek had a population of 345. Dividing Creek is located on County Route 553 9.7 miles (15.6 km) south-southwest...

Shows 1946–Present (9 ed.). New York: Ballantine Books. p. 526. ISBN 978-0-345-49773-4. Retrieved January 3, 2026. Brooks, Tim; Marsh, Earle (2007). "Happy"...

ISBN 0-345-44892-8. The Gates of Dawn (2003), ISBN 0-345-44894-4. The Scrolls of the Ancients (2004), ISBN 0-345-44896-0. Savage Messiah (2005), ISBN 0-345-47707-3...

study on the genus Homonopsis from China (Lepidoptera: Tortricidae: Tortricinae). Acta Zoologica Cracoviensia 46 (4): 339-345. Full article: [1] v t e...

Zabaykalsky Krai, Russia. Population: 190 (2021 census); 255 (2010 census); 345 (2002 census); There are 4 streets in this selo. This rural locality is located...

of 345° and ends when it reaches the longitude of 360°. More often, it refers to the day when the Sun is exactly at a celestial longitude of 345°. In...

(2000:145). Project Samnordisk Runtextdatabas Svensk - Rundata entry for DR 345. Nielsen, Michael Lerche (2000). "Swedish Influence in Danic Runic Inscriptions"...

study of the Chinese Lecithocera Herrich-Schäffer, 1853 and descriptions of new species (Lepidoptera:Lecithoceridae)". Sinozoologia. 10: 319-345. v t e...

Eudasyphora Townsend (Diptera: Muscidae), and reflections on its evolution". The Canadian Entomologist. 112 (4): 345–373. doi:10.4039/Ent112345-4. v t e...

GBLD-345 is an anxiolytic drug used in scientific research, which acts as a non-selective, full-efficacy positive allosteric modulator of the GABAA receptor...

Australia. Its natural habitat is open seas. It is found at depths up to 345 meters. Sherman, C.S.; Derrick, D.; Kyne, P.M.; Treloar, M.A. (2021). "Spiniraja...

Tajpur has 122 houses with the total population of 669 persons of which 345 are male and 324 females. Literacy rate of Tajpur is 76.33%, higher than...

The Strand Theatre is a historic performing arts venue at 345 Main Street in downtown Rockland, Maine. Built in 1923 in the wake of a fire that destroyed...

(Special) (in Japanese). Vol. 42. Tokuma Shoten Intermedia. 15 April 1998. p. 345. ASIN B00J16900U. {{cite book}}: |work= ignored (help) NEW GAMES CROSS REVIEW:...

and Cable TV Shows 1946-Present. Ballantine Books. 2003. p. 556. ISBN 0-345-45542-8. TV Guide. "House Rules Episodes". TV Guide. Retrieved September...

Shows 1946–Present (9 ed.). New York: Random House Publishing. p. 378. ISBN 978-0-345-49773-4. Retrieved May 27, 2024. The Don Knotts Show at IMDb v t e...

Crystallographica Section B: Structural Crystallography and Crystal Chemistry. 32 (2): 345–348. doi:10.1107/S0567740876003026. VanAllan, J. A.; Deacon, B. D. (1950)...

Brown at the Palomar Observatory in California. It measures approximately 345 kilometers in diameter. 2001 YH140 is locked in 3:5 mean-motion resonance...

added to the National Register of Historic Places in 1984. It is located at 345 East Main Street. Its Georgian Revival details include a Palladian portico...

Empire Strikes Back Sketchbook. New York: Ballantine Books. p. 69. ISBN 978-0-345-28836-3. Windham & Ling 2000, p. 39. Windham & Ling 2000, p. 45. "The Legendary...

Census Handbook, Bhiwani Village and Town Directory" (PDF). cenusindia. p. 345. Archived from the original (PDF) on 15 August 2023. Bardu Chaina Haryana...

jurisdiction of Hof HaCarmel Regional Council. In 2024 it had a population of 345. The village was established following the 1948 Arab–Israeli War when 35...

Selsoviet, Zianchurinsky District, Bashkortostan, Russia. The population was 345 as of 2010. There are 4 streets. Malinovka is located 59 km southeast of...

Pardee Dam is a 345-foot-high (105 m) structure across the Mokelumne River which marks the boundary between Amador and Calaveras Counties, located in...

equal number of Greek and Turkish Cypriots. In 2011, its population was 345. Alaminos is the site of discovery of a Chalcolithic clay feminine "lactation"...

Shaughnessy v. United States ex rel. Mezei, 345 U.S. 206 (1953), was a United States Supreme Court case that established the federal government's power...

football and chronic traumatic encephalopathy (CTE). He is one of at least 345 NFL players to be diagnosed after death with this disease, which is caused...

Ballantine Books. pp. 11–12. ISBN 0-345-38456-3. Armstrong, Karen (1993). A History of God. Ballantine Books. pp. 13–14. ISBN 0-345-38456-3. Armstrong, Karen (1993)...

French professional footballer who played as an attacking midfielder. He made 345 appearances and scored 51 goals in Ligue 1 for Lille, Bastia, Brest, Nice...

He was Roman consul in the year 341 and praefectus urbi of Rome from July 345 to December 346. Probinus was the son of Petronius Probianus, a consul and...

is a town in Forest County, Wisconsin, United States. The population was 345 at the 2010 census. According to the United States Census Bureau, the town...

had been selected. In 2024, TerraPower selected Kemmerer as the site for a 345 MWe Natrium reactor. The company submitted their application for a nuclear...

is a village in Door County, Wisconsin, United States. The population was 345 at the 2020 census. The village is known for its white buildings, its views...

350 BC–346 BC) Dionysius the Younger (restored, 346 BC–344 BC) Timoleon (345 BC–337 BC) Timoleon revived a republican form of government in Syracuse,...

Route 345 is a 7-kilometre (4.3 mi) long east–west secondary riverfront highway in the north-east portion of New Brunswick, Canada. The route's eastern...

switch ES-345 (1958–1981) ES-335 construction, but with parallelogram inlays, Varitone, and stereo outputs. ES-347 (1978–c. 1990s) Alternate ES-345 with a...

School Street Duplexes are a pair of historic two-family worker houses at 343-345 and 347-349 School Street in Bennington, Vermont. Built about 1916, they...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1684. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1690. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1693. ISBN 978-0-345-49773-4....

Network and Cable TV Shows - 1946-Present (2007) (9 ed.). p. 328. ISBN 978-0-345-49773-4. Retrieved 2019-10-25. Dunning, John (1998). On the Air: The Encyclopedia...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1691. ISBN 978-0-345-49773-4....

Insulin Therapy in Critically Ill Patients". New England Journal of Medicine. 345 (19): 1359–1367. doi:10.1056/NEJMoa011300. ISSN 0028-4793. PMID 11794168...

(c. 1500 – c. 545 BCE) Kuru kingdom (c. 1200 – c. 345 BCE) Indian Iron Age kingdoms (c. 600 – c. 345 BCE) Pandyan Kingdom (c. 600 BCE – c. 650 CE) Pradyota...

mainly in open forest. Hay, A (1993). "The genus Typhonium (Araceae-Areae) in Australasia". Blumea. 37 (2): 345–376. Retrieved 30 September 2021. v t e...

TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1693. ISBN 978-0-345-49773-4. Brooks, Tim; Marsh, Earle (2007). The Complete Directory to Prime...

transformed roots of Datura stramonium". Plant Cell Reports. 18 (3–4): 341–345. doi:10.1007/s002990050583. Lanoue, A.; Boitel-Conti, M.; Portais, J.-C.;...

Compilation. Salt Lake City: University of Utah Press. p. 36. ISBN 978-0-87480-345-7. OCLC 797284427. Retrieved March 10, 2018. Media related to Birdseye, Utah...

time of the 1991 Nepal census it had a population of 1697 people living in 345 individual households. "Nepal Census 2001", Nepal's Village Development Committees...

History of Burgundy Duchy of Burgundy Kingdom of Arles Bouchard 1999, p. 328–345. Hauff 2017, p. 1–12. Jackman 2008, p. 14. Wood 2006, p. 320. MacLean 2003...

345 first flew in June 1935 but by this time Morane-Saulnier were concentrating on the MS.405/6 fighter and in the absence of orders for the MS.345 development...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1694. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1687. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1689. ISBN 978-0-345-49773-4....

for the USC Trojans. Bender died on March 5, 2018. He was one of at least 345 NFL players to be diagnosed after death with chronic traumatic encephalopathy...

Odilon Redon: Prince of Dreams, Chicago: Art Institute of Chicago, 1994, pp. 345–346. Stephen F. Eisenman, The Temptation of Saint Redon, University of Chicago...

Ballantine, 1971) ISBN 0-345-09798-X Guderian (New York: Ballantine, 1973) ISBN 0-345-03385-X Rundstedt (New York: Ballantine, 1974) ISBN 0-345-23790-0 Dien Bien...

Part 10. Mollusca, Gastropoda, Naticidae. Zoologische Mededelingen 73(25): 345-380 "Tanea areolata". Gastropods.com. Retrieved 15 April 2011. v t e...

and Cable TV Shows, 1946-Present. Ballantine Books. 2003. p. 1198. ISBN 0-345-45542-8. "Despite pretentions, 'Three' is just mindless entertainment". February...

block of Bhojpur district in Bihar, India. As of 2011, its population was 345, in 47 households. Located 2 km east of Jagdishpur, Dulaur is known as having...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1697. ISBN 978-0-345-49773-4....

MNHS, 345 Kellogg Blvd, St. Paul MN [7] Enroute to Pipestone, The Saint Paul Globe Aug. 9, 1897, p.2, Minnesota Digital Newspaper Hub, 2024, MNHS, 345 Kellogg...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1695. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1684. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1685. ISBN 978-0-345-49773-4....

Abyss Beyond Dreams (2014), ISBN 978-0-345-54719-4 Night Without Stars (2016), ISBN 978-0230769496 (UK), ISBN 978-0-345-54722-4 (US) Hamilton announced in...

de Bruxelles". Annales de la Société Entomologique de Belgique. 41: 345–362 [345]. Bonato L.; Chagas Junior A.; Edgecombe G.D.; Lewis J.G.E.; Minelli...

County and crosses a few miles into Elbert County. About 45 miles (72 km) of 345 kV transmission line connect the wind farm substations to the Xcel Energy...

T-intersection with SR 345, SR 669 heads northeast concurrent with SR 345. The road passes through residential area, before SR 669 leaves SR 345. SR 669 heads...

a Mahajanapada in ancient India which existed between 700 BCE and 425 or 345 BCE according to the Buddhist texts and Puranas. It included areas in present...

and Cable TV Shows, 1946-Present. Ballantine Books. 2003. p. 254. ISBN 0-345-45542-8. "Scores hit in "Cowboy in Africa"". Ebony. Johnson Publishing Company...

export, powered by a Perkins 6.345 engine ZIL-136IG – long wheelbase diesel version for export, powered by a Perkins 6.345 engine ZIL-136IDI – export diesel...

Carboniferous period and in the Osagean age of United States, from 353.8 to 345.0 Ma. Agaricocrinus americanus Roemer Agaricocrinus splendens Miller and...

Kirada (Brahmi: Ki-ra-da, ruled 335-345 CE), is considered by modern scholarship as the first known ruler of the Kidarite Huns in the area of Gandhara...

Mayurasharma, spelled Mayuravarma by modern scholars (reigned 345–365), a native of Talagunda (in modern Shimoga district), was the founder of the Kadamba...

History of the Men's Game. New York, NY: ESPN Books. p. 533. ISBN 978-0-345-51392-2. "Wisconsin Record Book" (PDF). Archived from the original (PDF)...

The Complete Guide. New York, New York: Del Rey. pp. 459–460. ISBN 978-0-345-48590-8. OCLC 85833345. Thompson, Jason (October 9, 2007). "Adult Reviews"...

Lobdell and artist Joe Madureira, and first appeared in The Uncanny X-Men #345 (June 1997). Maggott is first seen as a mysterious mutant who is searching...

a mountain located on the island of Streymoy, Faroe Islands. Standing at 345 metres (1,132 ft) above sea level, it is dwarfed by other Faroese mountains...

Nectar, p. 183 Za'd Al-Ma'ad 2/91-108 Ibn Hisham 2/60-129 Fath Al-Bari 7/345-377 Mukhtasar Seerat Ar-Rasool p.242-275 Alfred Guillaume (translator), The...

related to this article: Fowler v. Rhode Island Fowler v. Rhode Island, 345 U.S. 67 (1953), was a case in which the Supreme Court of the United States...

Kruševac, Serbia. According to the 2002 census, the village has a population of 345 people. Popis stanovništva, domaćinstava i Stanova 2002. Knjiga 1: Nacionalna...

Route 345 is a 16.1-kilometre-long (10.0 mi) north-south highway on New World Island in the Canadian province of Newfoundland and Labrador. It connects...

Edison substation in Gowanus, Brooklyn, New York, by a 6.5-mile (10.5 km), 345-kilovolt underwater transmission line across the Upper New York Bay. This...

ed. D. Whitelock. English Historical Documents 1. 2nd ed. London, 1979. 345–6. Excerpts relevant to King Æthelstan of England from chapters 27 and 29...

Compilation. Salt Lake City: University of Utah Press. p. 45. ISBN 978-0-87480-345-7. OCLC 797284427. Retrieved March 10, 2018. The Utah Genealogical and Historical...

Kohgiluyeh and Boyer-Ahmad Province, Iran. At the 2006 census, its population was 345, in 83 families. Dehve at GEOnet Names Server "Census of the Islamic Republic...

December 9, 2016. ESPN College Basketball Encyclopedia: The Complete History of the Men's Game. Random House. 2009. pp. 932–933. ISBN 978-0-345-51392-2....

a leading member of the successful Barcelona team, scoring 280 goals in 345 appearances (including unofficial goals). During the club's 1999 centenary...

as Manitoba Highway 75. Its southern terminus is located at Interstate 345 (I-345) and Texas State Highway Spur 366 (Spur 366) in Dallas, Texas, where US...

and Cable TV Shows, 1946-Present. Ballantine Books. 2003. p. 633. ISBN 0-345-45542-8. "Rounding up the ratings for 'the season'" (PDF). www.americanradiohistory...

Complete Directory to Prime Time Network and Cable TV Shows, 1946-Present. Random House. p. 1945. ISBN 978-0-345-49773-4. Retrieved 28 January 2011. v t e...

Geographic Names: A Compilation. Salt Lake City: University of Utah Press. p. 105. ISBN 978-0-87480-345-7. OCLC 797284427. Retrieved 8 Feb 2018. v t e...

pp. [Pp. 1-344 published 1 Oct 1825; pp. 345-832 + errata published 13 Dec 1828 (in French), vol. 10, p. 345-832 [698], Wikidata Q130607910 "Genus Acanthonyx...

and Cable TV Shows, 1946-Present. Ballantine Books. 2003. p. 842. ISBN 0-345-45542-8. Collier, Aldore (August 27, 1990). "Sheryl Lee Ralph Talks About...

Wahpeton is a city in Dickinson County, Iowa, United States. The population was 345 at the time of the 2020 census. Wahpeton is part of the Iowa Great Lakes...

August 6, 2011. McDonough, Jimmy (2002). Shakey. New York: Anchor Books. p. 345. ISBN 0-679-75096-7. "Andrew McMahon in the Wilderness shares surprise new...

Oblast, Russia, and one of the main tributaries of the Oka. The river is 345 kilometres (214 mi) long, and has a drainage basin of 9,510 square kilometres...

- Vippetangen) 67 (Rush hour bus: Lørenskog Sentrum via Nyland Station) 345 (Rush hour bus: Vestvollen via Olavsgaard) 5N (Night bus: Vestli - Jernbanetorget)...

Prime Time Network TV Shows (9th ed.). New York: Ballantine. ISBN 978-0-345-49773-4. Castleman, H. & Podrazik, W. (1982). Watching TV: Four Decades of...

and Cable TV Shows, 1946-Present. New York: Ballantine Books. ISBN 978-0-345-49773-4. Retrieved May 28, 2021. The Donna Reed Show at epguides.com The...

Khyber-Pakhtunkhwa. It is located at 32°54'9N 70°32'3E and has an altitude of 345 metres (1135 feet). Tehsils & Unions in the District of Bannu - Government...

History of the Men's Game. New York, NY: ESPN Books. p. 545. ISBN 978-0-345-51392-2. "Nine accept NCAA bids; NIT lines up five teams". Spokesman-Review...

Atlas and Gazetteer (Map) (Second ed.). DeLorme. 2002. p. 31. ISBN 0-89933-345-1. "People in Zip 72721 (Combs, AR)". BestPlaces. Archived from the original...

Network and Cable TV Shows 1946–Present. Ballantine Books. 2003. pp. 869, 1433. ISBN 0-345-45542-8. Nurse at IMDb (series) Nurse at IMDb (pilot) v t e...

March 8, 2020. *ESPN College Basketball Encyclopedia: The Complete History of the Men's Game. Random House. 2009. pp. 899–900. ISBN 978-0-345-51392-2....

is a rural historic district in northern Mendon, Massachusetts. It covers 345 acres (140 ha), and extends predominantly along North Street, between Esty...

Charles; Hyams, Peter (1984). The Odyssey File. Ballantine Books. ISBN 978-0-345-32108-4. ""Sci-fi novelist leaves Soviet censors lost in space," The Ukrainian...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1682. ISBN 978-0-345-49773-4....

the 2011 census, the village comprised 72 households. The population of 345 was split between 174 men and 171 women. List of villages in Mawal taluka...

(Chondrichthyes: Myliobatiformes) based on new morphological and molecular insights". Zootaxa. 4139 (3): 345–368. doi:10.11646/zootaxa.4139.3.2. PMID 27470808....

Li-Wei; Qin, Wen-Min (2012). "A new species of Skeletocutis on bamboo (Polyporaceae) in tropical China". Mycotaxon. 119: 345–350. doi:10.5248/119.345....

Muḥammad At Al-Madina A.D. 622-626/Hijrah-4 A.H. SUNY Press. ISBN 978-0-88706-345-9. Siddiqi, Aslam (1963). "Jihād, an Instrument of Islamic Revolution". Islamic...

village in Schoharie County, New York, United States. The population was 345 at the 2010 census. The village was given the French name for "hope." The...

Del Rey, 2001. ISBN 0-345-44220-2. Slavicsek, Bill. A Guide to the Star Wars Universe 3rd ed.; New York: Del Rey, 2000. ISBN 0-345-42066-7. Sarlacc in the...

administrative center of the district. Its population as of the 2002 Census was 345. Registry of the Administrative-Territorial Divisions of the Sakha Republic...

County, Khuzestan Province, Iran. At the 2006 census, its population was 345, in 71 families. Maqate at GEOnet Names Server "Census of the Islamic Republic...

shows: 1946-present (3rd ed.). New York: Ballantine Books. p. 717. ISBN 978-0-345-31864-0. "Rita Moreno | Emmy Awards and Nominations". Television Academy...

Lipton (2016 population: 345) is a village in the Canadian province of Saskatchewan within the Rural Municipality of Lipton No. 217 and Census Division...

A Maze of Stars (ISBN 0-345-36541-0) is a science fiction novel by John Brunner. It was first published in the United States by Ballantine Del Rey Books...

1854, p. 345 cites Livy IX, 25. Titus Livius, Ab Urbe Condita 9.25.4.1 http://latin.packhum.org/loc/914/1/462/427-433 Bunbury 1854, p. 345 cites Romanelli...

Zabaykalsky Krai, Russia. Population: 226 (2021 census); 284 (2010 census); 345 (2002 census); There are 6 streets in this selo. This rural locality is located...

motorcycle division of Bridgestone from 1967 until 1971. It had an air-cooled 345 cc (21.1 cu in) two-stroke Straight-twin engine, which produced 37 hp (27...

modern divines, interspersed with notices of heretics and schismatics. p. 345. Irena Dorota Backus (30 November 1996). The Reception of the Church Fathers...

Compilation. Salt Lake City: University of Utah Press. p. 30. ISBN 978-0-87480-345-7. OCLC 797284427. Retrieved February 11, 2018. Climate Summary for Beryl...

(Canongate 1989, and Ballantine 1990), ISBN 0-345-37113-5 The Sensationist (Cape and Ballantine, 1991), ISBN 0-345-37935-7 Betrayals (Cape and Ballantine, 1993)...

has a maximum length of 110 km. The total catchment area of the basin is 345 square kilometres (133 sq mi). "Padalio River". guj-nwrws.gujarat.gov.in...

was broadcast in April 1979. Bendazzi, Giannalberto (2017). Animation: A World History. CRC Press, Taylor & Francis Group. p. 345. ISBN 9781138854529....

type. An extensively redesigned and modernised derivative, the Aermacchi M-345, has been developed by Alenia Aermacchi, and entered service in 2020. In...

football manager for Blackpool and Hartlepools United. He managed a total of 345 games, securing a 37.7 win-percentage over his career. William Lewis Norman...

Muscidae and Tachinidae (Dipt.) [concl.]". Entomologische Mitteilungen. 16: 345–357. O’Hara, James E.; Henderson, Shannon J.; Wood, D. Monty (5 March 2020)...

grows in open woodland. Hay, A (1993). "The genus Typhonium (Araceae-Areae) in Australasia". Blumea. 37 (2): 345–376. Retrieved 5 October 2021. v t e...

village in the Keşan District of Edirne Province in Turkey. Its population is 345 (2022). Köy, Turkey Civil Administration Departments Inventory. Retrieved...

Pleternica. According to national census of 2011, population of the village is 345. The village is connected by the D525 state road. Register of spatial units...

The Fuller Houses are two historic homes at 339–341 and 343–345 Broadway in Pawtucket, Rhode Island, United States. Constructed in 1896–1897, the two...

municipality of Elz. Its post code is 65604 and its dialing code is 06433. It has 345 inhabitants. Malmeneich lies in the Westerwald. Its average elevation is...

Wisconsin Domestic partnerships in Wisconsin Appling v. Doyle, 2013 WI App 3, 345 Wis. 2d 762, 826 N.W.2d 666. Appling v. Walker, 2014 WI 96, 358 Wis. 2d 132...

The neighborhood lies directly east of the elevated I-45/US 75 (unsigned I-345) freeway and extends to Exposition Avenue, connected to downtown by, from...

The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth Edition). Ballantine Books. p. 1687-1690. ISBN 978-0-345-49773-4....

ISBN 0-345-44756-5, March 2006) Command Decision (Hardcover ISBN 978-0-345-49159-6, February 2007) Victory Conditions (Hardcover ISBN 978-0-345-49161-9...

"Current status of annelid phylogeny". Organisms Diversity & Evolution. 16 (2): 345–362. Bibcode:2016ODivE..16..345W. doi:10.1007/s13127-016-0265-7. ISSN 1439-6092...

Shows 1946–Present (9th ed.). New York: Ballantine Books. p. 481. ISBN 978-0-345-49773-4. Retrieved May 2, 2026. Clyde Haberman Albin Krebs, "Notes on People"...

characteristics Crew: 1 Powerplant: 1 × Curtiss water-cooled inline engine, 257 kW (345 hp) Jan Forsgren (November 20, 2004). "Aircraft Production in Thailand"....

generation of 3-wheeler light cars powered by single-cylinder two-stroke engines of 345 cc and 3-speed gearboxes. About 75 were made. David (1913-1959)...

(Chondrichthyes: Myliobatiformes) based on new morphological and molecular insights". Zootaxa. 4139 (3): 345–368. doi:10.11646/zootaxa.4139.3.2. PMID 27470808....

Rey Manga. ISBN 978-0-345-47057-7. Clamp (2004). "Chapitre 2". Tsubasa: Reservoir Chronicle, Volume 1. Del Rey Manga. ISBN 978-0-345-47057-7. Clamp (2007)...

29, 2025. Riva, Maria (1992). Marlene Dietrich. Ballantine Books. ISBN 0-345-38645-0. Riva, Maria (2001). Marlene Dietrich: Photographs and Memories....

Himalayas, Thailand and Vietnam. Kew World Checklist of Selected Plant Families Flora of China, v 25 p 345, 足茎毛兰 zu jing mao lan, Eria coronaria v t e...

Babylon 5: Point of No Return. Random House Publishing Group. ISBN 978-0-345-42449-5. Robert E. McCarthy (1992). Secrets of Hollywood Special Effects...

Complete History of the Men's Game. Random House. 2009. p. 943–944. ISBN 978-0-345-51392-2. "Iowa drops one notch in final poll" (PDF). The Daily Iowan. March...

Complete Directory to Prime Time Network and Cable TV Shows, 1946-Present. Ballantine Books. 2003. p. 462. ISBN 0-345-45542-8. Gideon's Crossing at IMDb...

direct injection petrol engine capable of producing 225 hp at 5,500 rpm and 345 Nm at 4,000 rpm. The Maxus EG10 electric van was based on the Maxus G10 van...

1895. Emery, C (1895). "Descriptions de quelques fourmis nouvelles d'Australie". Annales de la Société Entomologique de Belgique. 39: 345–358. v t e...

basidiomycetous anamorph genus with cruciform conidia". Mycoscience. 40 (4): 345–8. doi:10.1007/BF02463878. S2CID 84095276. Cruciger lignatilis in Index Fungorum...

on their geological record". Journal of Systematic Palaeontology. 6 (3): 345–366. doi:10.1017/S1477201907002350. S2CID 84468714. "Palaeos Vertebrates...

(2009). ESPN College Basketball Encyclopedia: The Complete History of the Men's Game. New York, NY: Random House, Inc. p. 66. ISBN 978-0-345-51392-2....

Barlow (1996). "New Malesian species of Viscaceae". Blumea. 41 (2): 339–345. ISSN 0006-5196. Wikidata Q96030590. Viscum exile occurrence data from GBIF...

der afrikanischen Lepidopteren-Fauna. Deutsche Entomologische Zeitung 1914:345-353. Wichgraf, F. (1918) Neue afrikanische Lepidopteren. Internationale Entomologische...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1695. ISBN 978-0-345-49773-4....

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1685. ISBN 978-0-345-49773-4....

where he played 3 seasons. His career statistics include 39 receptions for 345 yards and one touchdown. Lyons was elected to the Michigan State University...

It has a population of 346 people (31 December 2025). In year 2021 was 345 people by ethnicity 327 as Slovak, 18 as Not found out, 3 as Rusyn, 2 as...

(2007). The Complete Directory to Prime Time Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1692. ISBN 978-0-345-49773-4....

Earle (2007). The Complete Directory to Primetime Network and Cable TV Shows 1946-Present (Ninth ed.). Ballantine Books. p. 1679. ISBN 978-0-345-49773-4....

The Frey Block is an historic structure located at 345 Market Street in the Gaslamp Quarter, San Diego, in the U.S. state of California. It was built...

The Ice Harvest (Hardcover ed.). United States: Ballantine Books. ISBN 0-345-44018-8. Phillips, Scott (November 2000). The Ice Harvest (Hardcover ed.)...

professional tennis player. Makhkamov had best world rankings of 688 in singles and 345 in doubles. He featured in three editions of the President's Cup in Tashkent...

311 km (193 mi) 13 July 1910 — Grenoble to Nice, 345 km (214 mi) 15 July 1910 — Nice to Nîmes, 345 km (214 mi) 17 July 1910 — Nîmes to Perpignan, 216 km...

preseason polls. ESPN College Basketball Encyclopedia: The Complete History of the Men's Game. Random House. 2009. p. 899–900. ISBN 978-0-345-51392-2....

Complete History of the Men's Game. Random House. 2009. p. 590. ISBN 978-0-345-51392-2. "Kentucky Named National Champ in Final AP Poll". The Great Falls...

to northwestern Madagascar. It was first described by Mocquard in 1900: 345, and has been described numerous times since then, most recently by Townsend...

Nitrobacter species, N. Alkalicus sp. Nov". Archives of Microbiology. 170 (5): 345–52. doi:10.1007/s002030050652. PMID 9818354. S2CID 22734033. v t e...

south of the Woodall Rodgers Freeway at exit 284C of "hidden" Interstate 345 (signed as Interstate 45 southbound and US 75 northbound). From there, Central...

Group. 15 May 2007. ISBN 978-0-345-50029-8. The Map Thief. Random House Publishing Group. April 2009. ISBN 978-0-345-49469-6. Brigid of Kildare: A Novel...

The Soap Opera Encyclopedia (2nd ed.). Ballantine Books. p. 200. ISBN 0-345-35344-7. Copeland, Mary Ann (1991). Soap Opera History. Publications International...

Venango County, Pennsylvania: Her Pioneers and People. J. H. Beers. p. 345. 41°10′34″N 79°42′00″W / 41.17611°N 79.70000°W / 41.17611; -79.70000 v...

Arkansas Atlas & Gazetteer, DeLorme, 2004, 2nd edition, p. 26, ISBN 0-89933-345-1 "Howell County Place Names, 1928–1945 (archived)". The State Historical...

ESPN College Basketball Encyclopedia: The Complete History of the Men's Game. Random House. 2009. pp. 1119–1120. ISBN 978-0-345-51392-2. v t e v t e...

ISBN 0-345-34098-1 Shadow (1987), ISBN 0-345-34274-7 West of January (1989), ISBN 0-345-35836-8 Strings (1990), ISBN 0-345-36191-1 Hero! (1991), ISBN 0-345-37179-8...

locality situated in Åmål Municipality, Västra Götaland County, Sweden with 345 inhabitants in 2010. Fengersfors was originally named Lisefors after the...

The Soap Opera Encyclopedia (2nd ed.). Ballantine Books. p. 228. ISBN 0-345-35344-7. "Chi Dimout as TV Origination Center". Billboard. March 12, 1949...

scab-mites of domestic and wild mammals". Experimental and Applied Acarology. 66 (3): 337–345. doi:10.1007/s10493-015-9916-1. ISSN 0168-8162. v t e v t e...

Names : a Compilation. University of Utah Press. p. 98. ISBN 978-0-87480-345-7. 41°53′53″N 111°52′45″W / 41.8979831°N 111.8791142°W / 41.8979831; -111...

international encyclopedia, Volume 1. ABC-CLIO. p. 63. ISBN 978-1-57607-345-2. Lewin, Ronald (1980). Ultra Goes to War. New York: Pocket Books. pp. 86...

Municipality of Two Borders, Manitoba, Canada. The community is located on Highway 345 between the communities of Tilston and Bede, approximately 124 km south-west...

high-point with a lower elevation is Britton Hill in the state of Florida at 345 feet (105 m) above sea level. The Ebright Azimuth is located about 6.5 miles...

Complete Directory to Prime Time Network and Cable TV Shows 1946-Present. Ballantine Books. 2003. p. 261. ISBN 0-345-45542-8. Dalton James at IMDb v t e...

Network TV Shows, Third edition (New York: Ballantine Books, 1964) ISBN 0-345-31864-1 Pentagon (TV series) at IMDB DuMont historical website Archived February...

residence of the Duke and Princes of Arenberg in Belgium. List of castles in Belgium 50°12′54″N 5°20′42″E / 50.215°N 5.345°E / 50.215; 5.345 v t e...

Clyde.[citation needed] The HP-19C and HP-29C were introduced at MSRPs of $345 and $195, respectively. A version adapted to support an additional backward-facing...