DOSEN PROFIL LENGKAP

The .338 Lapua Magnum (8.6×70mm or 8.58×70mm) is a Finnish rimless, bottlenecked, centerfire rifle cartridge. It was developed during the 1980s as a high-powered...

Year 338 (CCCXXXVIII) was a common year starting on Sunday of the Julian calendar. At the time, it was known as the Year of the Consulship of Ursus and...

The .338 Norma Magnum is a rifle cartridge designed by Norma of Sweden. It was first introduced in 2008 and came into production in 2009. It is primarily...

The .338 Federal is a rifle cartridge based on the .308 Winchester case necked up to .33 caliber. It was created by Federal Cartridge and SAKO in 2006...

The SIG Sauer MMG 338, formerly known as the SIG Sauer MG 338 is a medium machine gun chambered in .338 Norma Magnum, manufactured by SIG Sauer. In 2017...

The .338 Winchester Magnum is a .338 in (8.6 mm) caliber, belted, rimless, bottlenecked cartridge introduced in 1958 by Winchester Repeating Arms. It...

The .338 Whisper (8.59x38mm) is a wildcat cartridge in the Whisper family, a group of cartridges developed in the early 1990s by J.D. Jones of SSK Industries...

The .338-06, also known as the .338 A-Square, is a cartridge based on the .30-06. As such, it allows heavier .338 caliber bullets to be used from the ...

ReBirth RB-338 is a software synthesizer for Microsoft Windows, Mac OS 8-9 and iOS for the iPhone, iPod Touch and iPad. It was developed by Propellerhead...

USA-338 (also known as KH-11 19 and NROL-91) is an American reconnaissance satellite which is operated by the National Reconnaissance Office. Launched...

338 Edge (.338/300 Ultra Mag, .338 Ultra Cat) is a Wildcat rifle cartridge based on the .300 Remington Ultra Magnum round necked up to accept 0.338" diameter...

The McMillan TAC-338 is a bolt-action rifle chambered in the .338 Lapua Magnum cartridge, designed and manufactured by McMillan Firearms for long-range...

The PGM 338, also known as the PGM .338 LM (LM - Lapua Magnum) or PGM Mini-Hecate .338, is French sniper rifle from the early 1990s (being produced since...

The Dewoitine D.338 was a 1930s French 22-passenger airliner built by Dewoitine. The D.338 was a late-1930s French airliner and served on long-distance...

Carp (SS/AGSS/IXSS-338), a Balao-class submarine, was the second ship of the United States Navy to be named for the carp. Carp (SS-338) was launched 12...

garden, dating back to 1593. It is located at 338 Liuyuan Rd. Suzhou, Jiangsu province, China (留园路338号). The garden is divided into 4 themed sections...

necked-up to accept a 0.338-inch (.338 caliber) bullet. The .338 Remington Ultra Magnum has a similar case capacity as the .338 Lapua Magnum and somewhat...

year in the Gregorian calendar; 337 days remain until the end of the year (338 in leap years). 98 – On the death of Nerva, Trajan is declared Roman emperor...

The .338 Xtreme cartridge (or .338 XT for short), is based on a necked down .505 Gibbs cartridge case with a sharper 35 degree shoulder angle. Introduced...

immediately after, she was transferred to the Turkish Navy, renamed as Yildirim (P-338). She was destroyed by an explosion & ensuing fire on 11 April 1985 off the...

The .338-378 Weatherby Magnum is based on the .338-378 KT, a wildcat cartridge created by Elmer Keith and R.W. "Bob" Thomson in 1966. The KT is based...

Symphony No. 34 in C major, K. 338, was written by Wolfgang Amadeus Mozart in 1780, and completed on 29 August that year. The work is scored for 2 oboes...

The .338 Marlin Express is a cartridge developed by Marlin Firearms and Hornady. It is based on the .376 Steyr with a goal to duplicate the venerable...

USS Wasmuth (DD-338/DMS-15) was a Clemson-class destroyer in the United States Navy following World War I. Henry Wasmuth was born c. 1840 in Germany....

The .338 Ruger Compact Magnum or .338 RCM is a rimless, short-length rifle cartridge based on the .375 Ruger case. Sturm Ruger and Hornady jointly developed...

The 338th Fighter-Bomber Squadron (Greek: 338 Μοίρα Διώξεως-Βομβαρδισμού, 338 MΔΒ), callsign "Ares", is a squadron in service with the Hellenic Air Force...

Provincial Road 338 (PR 338) is a 25.0-kilometre-long (15.5 mi) north–south gravel road in the Pembina Valley Region of southern Manitoba, Canada. It...

is named after the ancient city of Dan. The rifle is chambered for the .338 Lapua Magnum cartridge. The rifle was designed by Dr. Nehemia Sirkis with...

January 27 is the 27th day of the year in the Gregorian calendar; 338 days remain until the end of the year (339 in leap years). 98 – Trajan succeeds...

State Route 338 (SR 338) was a state highway in the southeastern portion of the U.S. state of Ohio, entirely in Meigs County. Running along the Ohio River...

State Road 338 (NM 338) is a 24.440-mile-long (39.332 km) state highway in the US state of New Mexico. NM 338's southern terminus is in Animas where it...

denotes AWM rifles chambered in .338 Lapua Magnum. On 9 September 2012, Accuracy International announced that the .338 Lapua Magnum AWM rifle was phased...

338 Squadron may refer to: 338th Fighter-Bomber Squadron, Greece 338th Combat Crew Training Squadron, United States 338th Combat Training Squadron, United...

a winding two-lane SR 338. On the West Virginia side, the bridge carried West Virginia Route 338. In 2003, the SR 824 and WV 338 designations were removed...

Scheduled Castes in India. Article 338 of the Indian constitution deals with National Commission for Scheduled Castes. Article 338 A deals with National Commission...

New York State Route 338 (NY 338) was a state highway in Saratoga County, New York, in the United States. It served as a bypass of the village of Schuylerville...

Retrieved 2020-10-01. "338 Blaser Mag" (PDF). C.I.P. 2009-05-05. Retrieved 2020-10-13. "SAAMI New Cartridge & Chamber – .338 Weatherby Rebated Precision...

Arkansas Highway 338 (AR 338) is an east–west state highway in Pulaski County, Arkansas. The highway begins at Highway 5 in Little Rock and runs east...

- 335 or 338) was an Armenian military officer from the Mamikonian family, nakharar, sparapet (generalissimo) of Kingdom of Armenia (310–338), prince...

The siege of Nisibis of 338 constituted the initial phase of Perso-Roman wars of 337–361. Shapur besieged Nisibis, which was then regarded as the key...

United Nations Security Council Resolution 338 was a three-line resolution adopted by the UN Security Council on 22 October 1973, which called for a ceasefire...

including fourteen hull-loss accidents and two hijackings, for a total of 338 fatalities. On 30 June 1994, Airbus Industrie Flight 129, an Airbus A330-321...

The Rural Municipality of Lakeside No. 338 (2016 population: 415) is a rural municipality (RM) in the Canadian province of Saskatchewan within Census...

Year 338 BC was a year of the pre-Julian Roman calendar. At the time it was known as the Year of the Consulship of Camillus and Maenius (or, less frequently...

all-new designs (which were collectively referred to by the designation of MB-338) against an improved version of the MB-326, which was designated MB-339....

municipality of Vila Nova de Foz Côa, Portugal. The population in 2011 was 338, in an area of 32.10 km2. Instituto Nacional de Estatística "Áreas das freguesias...

village in the Çorum District of Çorum Province in Turkey. Its population is 338 (2022). Köy Archived 6 March 2023 at the Wayback Machine, Turkey Civil Administration...

State Route 338 (SR 338) is a state highway in Lyon County, Nevada, United States. It connects the towns of Smith and Wellington to the California state...

.338 Lapua Magnum cartridge has functioned as the parent case for the 7.62mm UKM, which is essentially a necked-down shortened version of the .338 Lapua...

Highway 338 (WYO 338) is a 15.03-mile-long (24.19 km) north-south Wyoming State Road located in north-central Sheridan County. Wyoming Highway 338 begins...

of the England national football team results from 1960 to 1979 (matches 338–536). Scotland  v  England England  v  Yugoslavia Spain  v  England Hungary ...

338 Pitt Street is a proposed skyscraper complex in Sydney, New South Wales, Australia, consisting of twin 80 storey towers designed by FJCstudio and...

The (Second) Latin War of 340–338 BC was a conflict between the Roman Republic and its neighbors, the Latin peoples of ancient Italy. It ended in the...

Route 338, or Highway 338, may refer to: Manitoba Provincial Road 338 Prince Edward Island Route 338 Quebec Route 338 Main road 338 (Hungary) Japan National...

International AXSR and AXMC .338 Lapua Magnum .338 Remington Ultra Magnum .338-378 Weatherby Magnum .338-416 .338 Chey Tac .338 Edge .338 Xtreme 8 mm caliber List...

Canadian federal election. The NDP nominated candidates in all of Canada's 338 ridings; 25 of whom were elected. Following the election, the NDP remained...

produces Record target rifles chambered in .308 Winchester, 7.62×54mmR and .338 Lapua Magnum which are similar to the SV-98. According to the manufacturer...

a moon of Jupiter. Its coordinates are at 48°53′S 338°46′W / 48.89°S 338.77°W / -48.89; -338.77 (Euboea Montes). It is about 10.5±1 km high, and...

The Bagel Bakers Local 338 was a trade union local that was established in the early 1900s in New York City and whose craftsmen were the primary makers...

four cylinder banks in four cylinder rows. These were the 16-184 and 16-338 "pancake" engines. The 16-388 engine was 13.5 feet (4.1 m) from the base...

The Capital Plaza Office Tower was a 338-foot tall, 28-story office skyscraper located at 500 Mero Street in Frankfort, Kentucky. It was the tallest building...

AWM (Arctic Warfare Magnum) chambered in either .300 Winchester Magnum or .338 Lapua Magnum, and the AW50 (Arctic Warfare .50 calibre) chambered for the...

USS Martin H. Ray (DE-338) was an Edsall-class destroyer escort built for the U.S. Navy during World War II. She served in the Atlantic Ocean and the...

the state of Former Yan against the Later Zhao dynasty from 12 to 16 June 338 during the Sixteen Kingdoms period. Following the breakdown of their alliance...

The Battle of Pedum was fought in 338 BC, near Pedum between the Roman Republic and multiple cities in Latium: Tibur, Praeneste, Antium, Aricia, Lanuvium...

parent case of the .300 Lapua Magnum is the .338 Lapua Magnum necked down to a smaller caliber. The .338 cartridge case was selected to withstand high...

(born 10 October 1961) is an English former professional footballer who made 338 appearances in the Football League and Premier League playing as a striker...

mixture into quenelle shapes or rounds that are deep-fried at 170 to 180 °C (338 to 356 °F). The dish is named for the Dauphine of France, wife of the heir...

Hermopolis, Egypt, and dated to the third century BCE. It contains lines 338-344 of the stasimon and the musical notation for both the vocals and instruments...

State Route 338 (SR 338) is a secondary highway located entirely within Sevier County in East Tennessee. The road runs generally south–north although...

soon subsequently developed other versions, with both the Rangemaster 338 in .338 Lapua Magnum and the subsonic short range Rangemaster 7.62 Standby in...

Kollhoff-Tower is a 25-story, 103 metres (338 ft) skyscraper on the Potsdamer Platz in Berlin, Germany. The building, named after Hans Kollhoff from Kollhoff...

Minuscule 338 (in the Gregory-Aland numbering), ε 1006 (Soden), is a Greek minuscule manuscript of the New Testament, on parchment. Palaeographically...

borough in Clarion County, Pennsylvania, United States. The population was 338 at the 2020 census. St. Petersburg is located in western Clarion County at...

commentary website that was founded in 2017. The website's name refers to the 338 federal constituencies that were represented in the House of Commons between...

Churachandpur district of Manipur. It has a population of 676 of which 338 are males while 338 are females as per Population Census 2011 Sangaikot has its own...

response to the .338 Winchester Magnum released in 1958. The .340 Weatherby Magnum uses the same .338 in. diameter bullets as the .338 Winchester Magnum...

Lectionary 338 (Gregory-Aland), designated by siglum ℓ 338 (in the Gregory-Aland numbering) is a Greek manuscript of the New Testament, on parchment....

is a town in Garrett County, Maryland, United States. The population was 338 at the 2020 United States census. Accident has been noted for its unusual...

luxury expedition cruise line that operated the German-built 103-metre (338 ft) 4,000-gross ton cruise ship MV Orion in Australasian and Antarctic waters...

State Highway 338 (SH 338) is a 6.722-mile (10.818 km) state highway in the U.S. state of Texas. The highway begins at a junction with U.S. Highway 259...

(BELL) known as the .338/416. The Lapua uses a modified .416 case shortened and necked down to accept a 8.59-millimetre (0.338 in) bullet. The cartridge...

New York State Route 338 may refer to: New York State Route 338 (1930s) in Allegany and Steuben Counties, from Whitesville southeast to Pennsylvania New...

Metropolitan Region. The majority of the road constitutes Highway 338 (ทางหลวงแผ่นดินหมายเลข 338). Borommaratchachonnani Road begins at Borommaratchachonnani...

Oklahoma, United States. As of the 2020 census, the town’s population was 338. Optima is located approximately nine miles northeast of Guymon on U.S. Route...

uses the larger 77 kWh battery and delivers a combined output of 252 kW (338 hp; 343 PS). It is one of Toyota’s most powerful vehicles, excluding the...

The Battle of Chaeronea was fought in 338 BC, near the city of Chaeronea in Boeotia, between Macedonia under Philip II and an alliance of city-states...

Kippur War where Resolution 338 two days before had failed. The resolution primarily reaffirmed the terms outlined in Resolution 338 (itself based on Resolution...

Ruger M77 rifle to adapt them to the new Ruger cartridge. The .338 Ruger Compact Magnum or .338 RCM is a rimless, short-length rifle cartridge based on the...

volume 338 of the United States Reports: Supreme Court of the United States (www.supremecourt.gov) United States Supreme Court cases in volume 338 (Open...

on Monday, 21 October 2019. Candidates have been declared for each of the 338 electoral districts or "ridings". Animal – Animal Protection Party of Canada...

achieve desired range capabilities, the .338-caliber was chosen, specifically the .338 Norma Magnum over the .338 Lapua Magnum for several reasons including...

[citation needed] The Stealth Recon Scout was originally designed around the .338 Lapua Magnum cartridge, but is also available in many other calibers, including;...

Gibson v. United States, 329 U.S. 338 (1946), was a case in which the Supreme Court of the United States ruled that a Jehovah's Witness minister could...

Karu, Abuja, Nigeria established in September 2002. It has approximately 338 students and 70 staff. Official website Okoli, Ada. "Information management...

Virginia, United States. As of the 2020 census, Goshen had a population of 338. The town is known for hosting Goshen Scout Reservation, one of the largest...

Kōnomine-jō) is a castle structure in Yamaguchi, Japan. It is located on a 338 meter mountain. Kōnomine Castle was built in 1556 by Ōuchi Yoshinaga as a...

This is a list of the 338 federal electoral districts as they existed between 2015 and 2025 (also known as ridings in Canadian English) as defined by...

Mississippi Highway 338 (MS 338) is a 11.943-mile-long (19.220 km) east-west state Highway in Pontotoc County, Mississippi. It serves as a business loop...

In 341–338 BC, the Latin states jointly fought the Latin War against Rome in a final attempt to preserve their independence. The war ended in 338 BC with...

States. It is part of the Burley, Idaho micropolitan area. The population was 338 at the time of the 2020 Census, down from 343 in 2010. East of Burley and...

mountain on Reykjanes peninsula, Iceland. The height of the mountain is 338 m. Many mountains in Iceland bear the name of Helgafell. It means “holy mountain”...

accept a .338 bullet - The 338-06 gives shooters the option of using heavier bullets for bigger game while suffering less recoil than other .338 caliber...

German submarine U-338 was a Type VIIC U-boat of Nazi Germany's Kriegsmarine during World War II. The submarine was laid down on 4 April 1941 at the Nordseewerke...

river in Khanty-Mansi Autonomous Okrug in Russia. It is 544 kilometres (338 mi) long, and its basin covers 32,200 square kilometres (12,400 mi2). The...

SP-338 is a state highway in the state of São Paulo in Brazil. "Pesquisa de Rodovias". DER/SP. Retrieved 2023-03-10. v t e...

Illinois. As of the 2010 census, its population was 668 and it contained 338 housing units. According to the 2010 census, the township has a total area...

State Route 338 (SR 338) is a 22.3-mile-long (35.9 km) state highway that travels south-to-north in a sideways V-shape completely within Laurens County...

needed] due to the need of finding suitable ammo. The Barak is chambered .338 Lapua Magnum with a 28-inch (711 mm) barrel and can achieve accuracy of 0...

in Florida in 2022.[citation needed] In FY 2022, the company ranked No. 338 on the Forbes list of America's Largest Private Companies and had sales of...

elected consul in 338 BC and appointed dictator twice, in 320 BC and 314 BC. Hailing from a plebeian family, Maenius was elected consul in 338 BC alongside...

(425 BC–338 BC), Artaxerxes III Ochus, r. 358–338 BC, son and successor of Artaxerxes II Artaxerxes IV (died 336 BC), Artaxerxes IV Arses, r. 338–336 BC...

Bennington, New Hampshire, United States. The population of the CDP was 338 at the 2020 census, out of 1,501 in the entire town. The CDP is in the western...

Brinegar v. United States, 338 U.S. 160 (1949), was a United States Supreme Court case employing the "reasonableness test" in warrantless searches. The...

Pennsylvania Route 338 (PA 338) is a 13.6-mile-long (21.9 km) state highway located in Clarion County, Pennsylvania. The western terminus is at PA 58...

338 Budrosa is a large Main belt asteroid. It is classified as an M-type asteroid. It was discovered by Auguste Charlois on 25 September 1892 in Nice...

Magnum, and .338 Lapua Magnum. It is reported to have 0.7 MOA average accuracy at 1,000 m (1,094 yd) with both Barnes and ATK 300 gr (19.4 g) .338 Lapua Magnum...

originally developed for the Italian Army, and was designed to shoot the .338 Lapua cartridge. The design of the rifle is based on the Remington Model...

of Teratologies in Scarabaeoidea. The Coleopterists Bulletin, 71(2), 329–338. doi:10.1649/0010-065x-71.2.329 "Pachnoda fissipuncta Kraatz, 1885". www...

Blackout (7.62×35mm) .300 Whisper .300 HAM'R – Wilson Combat .338 ARC .338 SOCOM (wildcat) .338 Spectre (wildcat) .350 Legend 357 Max AR (5.56 case straight...

and general who served as consul of the Roman Republic in 338 BC and in 325 BC. During his 338 BC consulship, he, along with Gaius Maenius, commanded Rome's...

The Latin League (c. 8th century – 338 BC) was an ancient confederation of about 30 villages and tribes in the region of Latium near the ancient city...

338 length=72 GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT +SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72...

Province of Perugia, Umbria, central Italy. It stands at an elevation of 338 metres above sea level. At the time of the Istat census of 2001, it had 243...

Anglesey, Wales, which is 130.6 miles (210.2 km) from Cardiff and 210.1 miles (338.2 km) from London. Google Maps (Map). Google. List of localities in Wales...

and Oxley Holdings, is scheduled to open in 2027. Towers 1, 2, and 3 are 338.6 metres (1,111 ft), 219.6 metres (720 ft), and 145.8 metres (478 ft) tall...

Undercover (Sep. 11, 2018). ISBN 978-1-338-14359-1 Mac B., Kid Spy: The Impossible Crime (Dec. 26, 2018). ISBN 978-1-338-14368-3 Mac B., Kid Spy: Top-Secret...

Award for "Rifle of the Year". In 2008, DPMS introduced the LR-338 chambered in the .338 Federal cartridge. DPMS's St. Cloud production facility with 115...

Jeffery .338 Edge .338 Federal .338 Lapua Magnum .338 Marlin express .338 Norma Magnum .338 Remington Ultra Magnum .338 Ruger Compact Magnum .338 Winchester...

Yozgat Province of Turkey. Its seat is the town of Aydıncık. Its area is 338 km2, and its population is 11,552 (2022). There are two municipalities in...

enjoy enormous prestige. The period following the end of the Latin War (340–338 BC) and of the Samnite Wars (343–290) saw the transformation of the Roman...

al Hamir) is the highest point of Qatar, with an altitude of 103 metres (338 ft). It is located south of the peninsula near the border to Saudi Arabia...

the Conservative Party of Canada ran a candidate in all but one of the 338 federal electoral districts. Ninety-nine of them won a seat in the House...

Ratchett) is a fictional DC Comics character. He first appeared in The Flash #338 (October 1984). Big Sir appears in the fourth season of The Flash, portrayed...

of Messina, Sicily, Italy. At an elevation of 1 m, its surface area is .338 km2. Together with the lake of Torre Faro it has been declared a particularly...

National Route 338 (国道338号, Kokudō San hyaku san jūhachigō) is a national highway in the Japanese prefectures of Hokkaido and Aomori. Route 338 stretches 241...

of Pernambuco. It lies in the mesoregion of Agreste of Pernambuco and has 338.12 sq/km of total area. State - Pernambuco Region - Agreste of Pernambuco...

Sanitary and evacuation aircraft. Tu-330TZ Aerial refueling tanker. Tu-330K (Tu-338) A proposed liquid natural gas-fuelled variant with a Samara NK-94 engine...

Aconius Catullinus signo Philomatius (fl. 338–349 AD) was a Roman senator who held high state offices under the emperor Constans. Aconius (or Aco) Catullinus...

China National Highway 338 will run from Haixing to Tianjun. It is one of the new trunk highways proposed in the China National Highway Network Planning...

of Pakistan. It is located at 34°17′18N 71°53′50E and has an altitude of 338 metres (1,109 ft). Takkar massacre Tehsils & Unions in the District of Mardan...

.300 RCM .300 Weatherby Magnum .303 British .308 Winchester .338 RCM .338 Federal .338 Winchester Magnum .348 Winchester .35 Remington .35 Whelen .357...

South Carolina Highway 324 (SC 324) is a 13.880-mile-long (22.338 km) state highway in the U.S. state of South Carolina. The highway connects York with...

CheyTac as the parent case, wildcatters have created .338 (.338 Little Dave (8.5×55mm). 338 Snipe-Tac. 338/408 Baer), .375 (.375 CheyTac, .375-.408 CheyTac...

Watts v. Indiana, 338 U.S. 49 (1949), was a United States Supreme Court case in which the court ruled that the use of a confession obtained through rigorous...

locality situated in Älmhult Municipality, Kronoberg County, Sweden with 338 inhabitants in 2010. "Tätorternas landareal, folkmängd och invånare per km2...

There are approximately 338 international schools operating in Qatar. The following are both national and international schools in Qatar (arranged in...

50 M☉ Radius 0.0142 R☉ Temperature 8,700 K Other designations SDSS J065133.338+284423.37, SDSS J0651, J0651, SDSS J0651+2844, WD+WD J0651+2844 Database...

Beach is a city in Pope County, Minnesota, United States. The population was 338 at the 2020 census. According to the United States Census Bureau, the city...

According to the 2006 census (INE), the municipality has a population of 338 inhabitants. List of municipalities in Cáceres National Statistics Institute...

Kotak means "little, short, small") was the king of Arsacid Armenia c. 330–338/339. Khosrov was the son and successor of King Tiridates III. Khosrov received...

Aomori. Route 394 stretches 185 km (115 miles) from National Routes 279 and 338 in Mutsu southwest to National Route 7 in Hirosaki. The route has a total...

was transferred to the Turkish Naval Forces and renamed TCG Uluçalireis (S 338), serving until 2000. She is now a museum ship at the Çanakkale Naval Museum...

and current President of France. As of June 2026, Emmanuel Macron has made 338 presidential trips to 100 states internationally since his inauguration on...

The Hino 600 (also known as the 145, 165, 185, 238, 258, 268, 338 and 358 nameplates), renamed as the L Series since the 2021 model year, is a conventional...

is a town in Taylor County, Wisconsin, United States. The population was 338 at the 2020 census. According to the United States Census Bureau, the town...

and district of Bigadiç, Balıkesir Province in Turkey. Its population is 338 (2022). Mahalle Archived 6 July 2015 at the Wayback Machine, Turkey Civil...

42°44′06″N 93°20′17″W / 42.735°N 93.338°W / 42.735; -93.338 The Whispering Willow Wind Farm – East in Franklin County, Iowa, USA, has a capacity of...

CB Radio", The Journal of Popular Culture, XIII (2): 338–344, doi:10.1111/j.0022-3840.1979.1302_338.x{{citation}}: CS1 maint: deprecated archival service...

USS LSM-338 was a LSM-1-class landing ship medium in the United States Navy during World War II. The ship was transferred to Thailand and renamed HTMS...

Richmond, Walworth County, Wisconsin, United States. Its population was 338 as of the 2020 census. Lake Koshkonong is located at coordinates 42°51′38″N...

village is populated by Kurds of the Mehmediyan tribe and had a population of 338 in 2021. "31 ARALIK 2021 TARİHLİ ADRESE DAYALI NÜFUS KAYIT SİSTEMİ (ADNKS)...

State Route 338 (SR 338) is a primary state highway in the U.S. state of Virginia. Known as Hillwood Avenue, the state highway runs 1.08 miles (1.74 km)...

Uddin v The Secretary of State for the Home Department [2020] EWCA 338 is a Court of Appeal case about immigration and the right to a family life. Asfar...

case from the 6.5mm Creedmoor necked up to an 8.6 mm caliber (8.585 mm or 0.338 in diameter) projectile. 8.6 Blackout is designed for use in bolt-action...

in London. It remains in the Royal Collection. Abrams p.33 Harrington p.338 Corbett p.207-8 https://www.rct.uk/collection/407523/edward-iii-with-the...

In Maryland v. Baltimore Radio Show, Inc., 338 U.S. 912 (1950), the United States Supreme Court held that denial of a writ of certiorari could not be...

Candidates for the Liberal Party of Canada took part in all the 338 electoral districts in the 2015 Canadian federal election. 184 of them won their seat...

(2R)-3-sulfolactate dehydrogenase (NADP+) (EC 1.1.1.338, (R)-sulfolactate:NADP+ oxidoreductase, L-sulfolactate dehydrogenase, (R)-sulfolactate dehydrogenase...

São Paulo in Brazil. The population is 13,859 (2020 est.) in an area of 338 km2. The elevation is 428 m. In telecommunications, the city was served by...

Rita v. United States, 551 U.S. 338 (2007), was a United States Supreme Court case that clarified how federal courts of appeals should implement the remedy...

over the years he became an all-rounder in the defensive sector, and made 338 appearances for the club, in addition to winning three state titles. In 2006...

township in Freeborn County, Minnesota, United States. The population was 338 at the 2000 census. Alden Township was organized in 1866. According to the...

2025. "Synonymy: Imshaugia aleurites (Ach.) S.L.F. Mey., Mycologia 77(2): 338 (1985)". Species Fungorum. Retrieved 12 June 2023. "Imshaugia aleurites (Ach...

Seine on 20 May 1922 in the Celtic Sea. 252 people were rescued from the 338 passengers and crew aboard at the time. A subsequent salvage operation recovered...

W-338 is a reserved Constituency for female in the Provincial Assembly of Punjab. Punjab portal Pakistan portal Punjab, Pakistan "Punjab Assembly | Members...

article: Koki Hirota v. General of the Army MacArthur Hirota v. MacArthur, 338 U.S. 197 (1948), was a decision by the Supreme Court of the United States...

القسم الثاني-الجزء الثاني، الهيئة المصرية العامة للكتاب، القاهرة، 1994، صــ: 338. البيانات السكانية لمدينة أو قرية حسب تقديرات السكان 2006 (محافظة البحيرة)...

locality situated in Södertälje Municipality, Stockholm County, Sweden with 338 inhabitants in 2010. "Tätorternas landareal, folkmängd och invånare per km2...

number of 138 houses and a population of 674 of which 336 are males while 338 are females. According to the report published by Census India in 2011, out...

the Indo-West Pacific. Zoological Journal of the Linnean Society 96: 281-338. Rudman, W.B., 2002 (February 4) Rostanga orientalis Rudman & Avern, 1989...

54°20′17″N 7°38′06″W / 54.338°N 7.635°W / 54.338; -7.635 Devenish College is a secondary school located in Enniskillen, County Fermanagh, Northern...

360 State Street is a 338-foot (103 m) residential skyscraper completed in 2010 in New Haven, Connecticut. It is the second-tallest building in the city...

New York State Route 338 (NY 338) was a 7.04-mile-long (11.33 km) state highway in Washington County, New York, in the United States. The western terminus...

requested calibers of .338 Lapua Magnum, .300 Winchester Magnum and .308 Winchester, Barrett also offers caliber conversion kits in .338 and .300 Norma Magnum...

Iowa, United States, along the East Nishnabotna River. The population was 338 at the time of the 2020 census. Elliott was founded in 1879. On March 14...

According to the 2004 census (INE), the municipality has a population of 338 inhabitants. National Statistics Institute (13 December 2025). "Municipal...

Abu Jaʿfar An-Nahhas (أبو جعفر النحاس; c. 874 CE – 949 CE; c. 260 AH – 338 AH) was an Egyptian Muslim scholar of grammar and Qur'anic exegete during the...

Kilis District, Kilis Province, Turkey. The village had a population of 338 in 2022. "Türkiye Mülki İdare Bölümleri Envanteri". T.C. İçişleri Bakanlığı...

Есмұханбет. — 2. — Астана: Фолиант, 2021. — 992 p. — 1000 экз. ISBN 978-601-338-848-9. "Умер первый министр энергетики независимого Казахстана Кадыр Байкенов"...

specialized neck morphology". Journal of Systematic Palaeontology. 14 (4): 319–338. doi:10.1080/14772019.2015.1051146. ISSN 1477-2019. Retrieved 25 January...

± 6 K Metallicity [Fe/H] 1.000 ± 0.001 dex Other designations Wurren, HR 338, CD−55°267, CPD−55°241, HD 6882, SAO 232306, HIP 5348 Database references...

declared an outlaw by the government and would be killed by the Qin armies in 338 BC. After Wei and Qi resolved their conflict, Qin began to expand extensively...

The molecular formula C21H22O4 (molar mass: 338.39 g/mol, exact mass: 338.1518 u) may refer to: Bergamottin, a natural furanocoumarin Licochalcone A,...

HMS Overdale Wyke (FY 338) was a Ceylonese steam turbine trawler launched in 1924, which served as a Minesweeping Trawler with the Ceylon Royal Naval...

Turkish). Retrieved 22 February 2026. Peter Alfred, Andrews; Benninghaus, Rüdiger, eds. (1989). Ethnic Groups in the Republic of Turkey. p. 338. v t e...

inhabited by Alevi Turkmens of the Chepni tribe and had a population of 338 in 2022. "Türkiye Mülki İdare Bölümleri Envanteri". T.C. İçişleri Bakanlığı...

linteus" complex from northern Argentina". Phytotaxa. 338 (1): 75–89. doi:10.11646/phytotaxa.338.1.6. hdl:11336/89616. Tian XM, Yu HY, Zhou LW, Decock...

and remained for 200 years the basis of the Roman military structure. From 338 to 88 BC, Roman legions were invariably accompanied on campaign by roughly...

as Wellington Road, the route serves as a shortcut connecting State Route 338 to State Route 208 near Wellington. Wellington Road was established as an...

Kingsland v. Dorsey, 338 U.S. 318 (1949), like Hazel-Atlas Glass Co. v. Hartford-Empire Co., is another patent fraud decision of the United States Supreme...

The Monticello Grange No. 338 is a historic civic building on United States Route 1 in the heart of Monticello, Maine. Built in 1922 by the local Grange...

The 338th Infantry Division (German: 338. Infanterie-Division) was a division of the German Army in World War II. In 1944, the division was in southern...

Bolu District, Bolu Province, Turkey. As of 2021, it had a population of 338 people. Köy Archived 2013-03-31 at the Wayback Machine, Turkey Civil Administration...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from...

French-controlled cloud computing, with the goal of spending €285 million (US $338 million) in "cloud souverain" ("sovereign cloud" in English). The launch...

the third tallest building in Hamilton, Ontario, Canada. The 103 metres (338 ft), 25-storey office skyscraper was completed in 1972, and is part of the...

United States. As of the 2020 census, Grand Junction had a population of 338. It has been called the "Bird Dog Capital of the World" and serves as the...

1983 (Diptera, Syrphidae) from the Andes Mountains". ZooKeys (338): 55–65. doi:10.3897/zookeys.338.6093. PMC 11331625. Retrieved 13 August 2021. v t e...

population is 2,512 (2020 est.) in an area of 222.96 km². The elevation is 338 m. IBGE 2020 Instituto Brasileiro de Geografia e Estatística https://web...

(or by Li Te in 303) and the state of Han (漢; Hàn) founded by Li Shou in 338. The state is also less commonly known as Later Shu (後蜀; Hòu Shǔ). The Li...

Magnum .338 Ruger Compact Magnum .338 Winchester Magnum .338 Remington Ultra Magnum .338 Norma Magnum .338 Lapua Magnum .340 Weatherby Magnum .338-378 Weatherby...

Retrieved 2008-11-04. Naklad Naprijet, The Croatian Adriatic Tourist Guide, pg. 338, Zagreb (1999), ISBN 953-178-097-8 "Establishing the Protection Status"....

unofficial tiered list of the Most Commercially Charming Cities in China, ranking 338 Chinese cities above or at the prefectural level based on the latest business...

Rav Safra (Hebrew: רב ספרא; around 280-338) was a Babylonian rabbi, of the fourth generation of amoraim. Safra studied under R. Abba, then went abroad...

the deepest cave dive in Great Britain and Ireland at a depth of 103 m (338 ft). Kozłowski came to Ireland from Poznań, in Poland, in 2006 and worked...

Pendergrass earned playing time as a true freshman, totaling 79 carries for 338 yards and five touchdowns, while also recording 26 receptions for 199 yards...

village has a total number of 141 houses and a population of 651 of which 338 are males while 313 are females according to the report published by Census...

Covered Bridge was 75 feet (23 m) long and carried McKee Road (Township 338) over Conneaut Creek. It was designed as single-span, multiple King post-truss...

W. Turner Costello p.147 Hamilton Constable p.326 Hamilton Constable p.338-39 "'Caligula's Palace and Bridge', Joseph Mallord William Turner, exhibited...

NGC 338 is a spiral galaxy in the constellation Pisces. Its velocity with respect to the cosmic microwave background is 4479 ± 22 km/s, which corresponds...

S. state of Michigan. As of the 2020 census, Conway had a population of 338. Conway is located in southeastern Emmet County, in southeastern Little Traverse...

mm (.223) variant designed for very-low-drag bullets .338 ARC (2025) — a necked up 8.6 mm (.338) (subsonic) variant .223 Remington 6mm AR 6 PPC 6.5mm...

Biographical Sketches, Part 1 Chicago: Western historical Company, 1880; p. 338 "List of Members of the Assembly of the State of Wisconsin" Wisconsin Express...

(1826). The Statutes of the United Kingdom of Great Britain and Ireland, Passed in the ... [1807-69]. His Majesty's statute and law Printers. pp. 338–400....

United States (1892). Lundmark, Thomas (2012-09-27). Charting the Divide Between Common and Civil Law. OUP USA. p. 338. ISBN 978-0-19-973882-3. v t e...

immovable historical and cultural monuments of local importance by decision No. 338 of the Cabinet of Azerbaijan, dated 3 November 2021. The house of Ismayıl...

Theagenes (Greek: Θεαγένης; died 338 BC) was a 4th century Greek Commander who served as the final commander of the Sacred Band of Thebes. He is best...

County. The route connects U.S. Route 395 in Bridgeport to Nevada State Route 338 at the Nevada state line via the East Walker River valley. SR 182 begins...

seen from afar and has shaped the cityscape for centuries, is 103 metres (338 ft) high. In the first half of the 13th century, a small church was built...

Thermaic Gulf in Greece, consisting of multiple wetlands. It covers an area of 338 km2 (131 sq mi) and is a Ramsar site, an Important Bird Area and part of...

2020[update] is estimated to be 9,275 people living in a total area of 877.844 km2 (338.937 sq mi). The city belongs to the mesoregion of Vale do Rio Doce and to...

Archidamus III (died 338 BC) /ˌɑːrkɪˈdeɪməs/ (Ancient Greek: Ἀρχίδαμος Archídamos) was the son of Agesilaus II and king of Sparta from 360 to 338 BC. While still...

Masturbation: From Angst to Zeal": by Martha Cornog. Down There Press, 2003, 338 pages, $22.00". Journal of Sex & Marital Therapy. 32 (1): 75–78. doi:10...

provisions of the lend-lease agreement, Vital was renamed HMS Strenuous (J.338), and subsequently served in the Royal Navy for the duration of World War...

البخاري الجرجاني الشافعي) also known as Al-Halimi (Arabic: الحليمي; 403–338 AH/ 949–1012 CE), was a highly influential Sunni scholar and regarded as...

ships and passenger vessels when she debuted. She is currently 1,111.3 feet (338.72 m) long and 155,889 GT, with a capacity of 4,635 passengers and 1,365...

Martin (2006). Saltwater Fishing Made Easy. Ragged Mountain Press. pp. 338–339. ISBN 007146722X. Gross, Chip (2008). Steelhead and Salmon: Use the Secrets...

with an addition to the fauna of Nova Scotia, Canada". ZooKeys (573): 265–338. Bibcode:2016ZooK..573..265W. doi:10.3897/zookeys.573.7327. PMC 4829930....

with a 660 mm fluted, stainless steel barrel (698 mm when chambered in .338 Lapua Magnum), cut to a twist rate between 1-in-10 and 1-in-12 depending...

average depth of 55 metres (180 ft) with a maximum depth of 103 metres (338 ft) at its narrowest point abreast the city of Çanakkale. The first fixed...

municipality and district of Yumurtalık, Adana Province, Turkey. Its population is 338 (2022). Mahalle Archived 2015-07-06 at the Wayback Machine, Turkey Civil...

Route 338 is a provincial highway located in the Montérégie region of Quebec west of Montreal. The highway runs from the Ontario Border near Rivière-Beaudette...

Botanic Garden Rosentreter, Roger (1993). "Vagrant Lichens in North America". The Bryologist. 96 (3): 333–338. doi:10.2307/3243861. ISSN 0007-2745. v t e...

seat as a Bangladesh Nationalist Party candidate in 2009. "Constituency 338". Bangladesh Parliament. Archived from the original on 21 December 2021....

kilometres (170 mi) north of the state capital of Shimla and 544 kilometres (338 mi) northeast of the national capital of New Delhi. Manali is a popular tourist...

Lok Sabha constituency. Since 2008, this assembly constituency is numbered 338 amongst 403 constituencies. Bharatiya Janta Party candidate Surya Pratap...

Illustrated Reference for More Than 1,500 Cartridges. Gun Digest Books. p. 338. ISBN 978-1440230592. Erenfeicht, Leszek (2018) (in Polish). From Russia...

is the name of the following ships of the Turkish Navy: TCG Yıldırım (P 338), ex-USS Defiance (PG-95), an Asheville-class gunboat transferred to Turkey...

historical and cultural monuments of local significance by Decision No. 338 of the Cabinet of Ministers of the Republic of Azerbaijan dated November...

instance, the 2017–18 FA Cup saw 77 teams compete from level 10 out of the 338 in total at that level. Below level 11, the pyramid becomes regional and...

MUZE. p. 894. MusicHound Rock: The Essential Album Guide. Visible Ink Press. 1999. p. 338. The Rolling Stone Album Guide. Random House. 1992. p. 196....

associations in 326 ridings, and ran candidates in 315 ridings, of Canada's total 338 ridings; however, no candidate was elected under its banner and Bernier lost...

California, located near Aetna Springs, California. It lies 1,109 feet (338 m) above ground. The reservoir is public and is a fishing spot. A fishing...

is not made with lead. Pewter has a low melting point, around 170–230 °C (338–446 °F), depending on the exact mixture of metals. The word pewter is possibly...

Ashley (1915). Springs of California. U.S. Geological Survey Water Supply Paper. Vol. 338. U.S. Government Printing Office. doi:10.3133/wsp338. v t e...

Verona. "Druga Kariera (338.): Matej Venta – Nekdanji košarkar uresničil idejo, kot je v Sloveniji še ni bilo(Second Career (338): Matej Venta – A former...

municipality in the province of Granada, Spain. In 2010, it had a population of 338. List of municipalities in Granada Wikimedia Commons has media related to...

time of the 1991 Nepal census it had a population of 1659 people living in 338 individual households. "Nepal Census 2001". Nepal's Village Development Committees...

and is located in the Borough of Waverley. Aarons Hill has a population of 338. Aarons Hill, as the name suggests, is on a hill. From the main road, Eashing...

produces 252 kW (343 PS; 338 hp) and 365 N⋅m (269 lb⋅ft). 2006–2008 E85 Z4 M Roadster, E86 Z4 M Coupé — produces 252 kW (343 PS; 338 hp) and 365 N⋅m (269 lb⋅ft)...

Canadian federal election. The NDP nominated candidates in all of Canada's 338 ridings; 24 of whom were elected. "Forty-third general election 2019, Official...

 51-52. ISBN 0-262-02405-5. Mollin, Richard (2003). RSA and Public-Key Cryptography. Boca Raton: Chapman & Hall/CRC. p. 80. ISBN 1-58488-338-3. v t e...

The Stop Tobacco Smuggling in the Territories Act of 2013 (H.R. 338) was a bill introduced into the United States House of Representatives in the 113th...

47°59′49″N 11°20′17″E / 47.997°N 11.338°E / 47.997; 11.338 St. Joseph is a Rococo church in Starnberg, Bavaria, Germany. It was built in the second...

powerful and dimensionally larger .300 Winchester Magnum (7.62×67mm) and .338 Lapua Magnum (8.6×70mm) cartridges. They are available with olive drab green...

California, United States. Its population is 334 as of the 2020 census, down from 338 from the 2010 census. McArthur is a small ranching community, located 4 mi...

County, Iowa, United States, along the Soldier River. The population was 338 at the time of the 2020 census. A post office called Ute has been in operation...

The Glemminge stone or DR 338 is a Viking Age runestone engraved in Old Norse with the Younger Futhark runic alphabet. It is found in the wall of Glimminge...

Province, Turkey. The village is populated by Arabs and had a population of 338 in 2021. "Türkiye Mülki İdare Bölümleri Envanteri". T.C. İçişleri Bakanlığı...

variant is available chambered in .260 Remington, .300 Winchester, .338 Federal, .338 Lapua Magnum, 6.5 Creedmoor, 6.5 x .284 Norma, and 7mm Remington....

chambered for the 7.62×51mm NATO cartridge. SVCh-8.6 variant chambered for the .338 Lapua Magnum (8.6×70mm). The upper receiver is enlarged and combined with...

Canadian federal election. The NDP nominated candidates in all of Canada's 338 ridings; 44 of whom were elected. Following the election, the NDP was the...

will be built by connecting Chhattisgarh and Maharashtra. The remaining 338 km of road will be built in Telangana. Expressways in Chhattisgarh Expressways...

Mandibular Molars in the Israeli Population." Journal of endodontics 41.3 (2015): 338-342. Agarwal, Manoj, et al. "The Radix Entomolaris and Radix Paramolaris:...

property and citizenship of their fathers through the Latin League, before 338 BC. Those with Latin rights had a privileged status above other Roman allies...

methodology for selecting most appropriate GIS software". Survey Review. 46 (338): 383–389. doi:10.1179/1752270614Y.0000000116. Eldrandaly, Khalid (2007)...

sophist (approximate date) Li Qi, Chinese emperor of the Cheng Han Dynasty (d. 338) Zhi Dun, Chinese Buddhist monk and philosopher (d. 366) January 10 – Miltiades...

measurements give a closer mean distance of 98.35 ± 10.89 Mly (30.154 ± 3.338 Mpc). It was discovered by German-British astronomer William Herschel on...

galaxy group known as LDC 1344, which includes the galaxies ESO 338-7 [d] and ESO 338-9 [d]. One supernova has been observed in NGC 6794: SN 2024dgn (Type Ia...

org. Comaish, James Stanley (23 June 2009). "Walter Brown Shelley". BMJ. 338 b2033. doi:10.1136/bmj.b2033. ISSN 0959-8138. Hunter, John (2009). "Walter...

the Barrett Model 98 Bravo) is a bolt-action sniper rifle chambered in .338 Lapua Magnum (8.6×70mm or 8.58×70mm) and manufactured by Barrett Firearms...

his 1848 book Memoirs of the Life of William Collins. Lambourne p.19 Roe p.338 https://collections.vam.ac.uk/item/O56220/the-stray-kitten-painting-coll...

and Their Origins: An Etymological Dictionary. Ktav Publishing House. p. 338. ISBN 9780881252972. This page lists people with the surname Heuberger. If...

houses offices, apartments, a fitness center, and retail stores. Rising 338.8 m (1,112 ft) tall, the Mercury City Tower was formerly the tallest building...

furniture at The Higgins Art Gallery & Museum in Bedford. Crook 2013, p. 338. UKSO 2011. Thistlewood, Jevon. "An Examination of William Burges's Great...

*Robert D. Crews, Amin Tarzi. The Taliban and the crisis of Afghanistan. Harvard University Press, 2008. ISBN 0-674-02690-X, 9780674026902. Pg 338. v t e...

Israel,1966, chap. XIV ("Kambodge"), p. 337 & Genealogical Chart No. 34 p. 338 (in) & (de) Peter Truhart, Regents of Nations: Asia: Systematic Chronology...

Study of Augustus' Vision of a New World Order in 13 BC. (2006), pgs. 337-338 Syme 1986, p. 87. Sherk, Robert K., The Roman Empire: Augustus to Hadrian...

Rumyantsev, "Kommunisticheskii universitet imeni Zinov'eva (Leningrad)," Istoki 1 (1989): 335-338. List of modern universities in Europe (1801–1945)...

Ancient Greek: Ἀρταξέρξης), was the twelfth Achaemenid King of Kings from 338 to 336 BC. Arses ascended the throne, after his father Artaxerxes III—who...

Kentucky Route 338 (KY 338) is a 32.228-mile-long (51.866 km) state highway in Kentucky. It begins at KY 20 in Northern Boone County. It goes through...

and district of Çermik, Diyarbakır Province in Turkey. Its population is 338 (2022). Mahalle Archived 6 March 2023 at the Wayback Machine, Turkey Civil...

Anthology Film Archives' Essential Cinema Repertory collection. Sitney 1979, pp. 338–339. Sitney 1979, p. 339. Sitney, P. Adams (May 2011). "The Ultimate Ken...

(Ancient Greek: Λυσικλῆς Lysikles; died 338 BC), one of the commanders of the Athenian army at the battle of Chaeronea, 338 BC, was subsequently condemned to...

their career games. For example, Jesse Bromwich played a career total of 338 first-grade games but of those, 43 were at the Dolphins. Previous club: refers...

2015 Canadian federal election. The Green Party nominated candidates in all 338 ridings. Results of the Canadian federal election, 2011 Results by riding...

violoniste pionnier (1928-2012). Rouen: Editions du Robec. ISBN 978-2-9564-338-0-4. "Devy Erlih". The Telegraph. 4 April 2012. Duchen, Jessica. "'UN MAUVAIS...

Hernán Cortés". Europa Press. 12 August 2010. Fernández Bremón 1890, p. 338. Fernández-Daza Álvarez 2013, p. 13. Paredes 2010. Carvajal 2010. Bibliography...

the throne in her favor. Ochus assumed the throne, but after his death in 338 BC, Atossa, like many other members of the family, was assassinated. Carsten...

Municipality in Andrés Ibáñez Province. It is situated at an elevation of 338 m, ten kilometers west of Río Grande, one of the largest rivers in the Bolivian...

338-378 KT, and .460 Short A-Square (11.63mm). Some .378-based derivatives have gone on to be part of the Weatherby line: namely, the .30-378, .338-378...

first floor of the Teatro Segura, it is now located on Jirón Huancavelica 338, behind the Municipal Theatre of Lima. The museum, originally installed on...

hundred metres southwest of the Kremlin. With an overall height of 103 metres (338 ft), it is the third tallest Orthodox Christian church building in the world...

Wales is a town in Sanpete County, Utah, United States. The population was 338 at the 2020 census. The town is governed by a mayor and several council members...

hacking: have fun while voiding your warranty. Rockland, MA: Syngress. pp. 332–338. ISBN 9780080478258. Internet Archive link Duntemann, Jeff (2004). Jeff Duntemann's...

(1902) Architektur im 20. Jahrhundert (in German). Vol. 3. Prestel. 1995. p. 338. ISBN 978-3-7913-1910-0. Retrieved 6 November 2024. Works by or about Ernesto...

II of Macedon and young Alexander the Great in the Battle of Chaeronea in 338 BC. The earliest surviving record of the Sacred Band by name was in 324 BC...

population of 119,346. Its headquarters are in Uromi/Uzea. It has an area of 338 km2 (131 sq mi) and a population density of 472.8 inhabitants per square...

Leonardo" The Annunciation Kemp (2019, p. 6): c. 1473–1474 Marani (2003, p. 338): c. 1472–1475 Syson (2011, p. 15): c. 1472–1476 Zöllner (2019, p. 216):...

The Strange Powers House is a historic house located at 338 North Main Street in Prairie du Chien, Wisconsin, United States. It is historically significant...

Queen Dowager Xuan of Qin (Chinese: 秦宣太后; personal name unknown (338 or 344 BC - 265 BC), also known as Mi Bazi (羋八子), was the first queen dowager in...

village in Zonguldak District, Zonguldak Province, Turkey. Its population is 338 (2022). Köy Archived 2015-07-06 at the Wayback Machine, Turkey Civil Administration...

A-Z: 6th edition: A Pocket Guide to the World Today. DK Publishing. pp. 338–. ISBN 978-1-4654-4252-9. Williams, Eric (1942). History of the People of...

108 total private dwellings, a change of -5.9% from its 2016 population of 338. With a land area of 2.72 km2 (1.05 sq mi), it had a population density of...

municipality and district of Elmalı, Antalya Province, Turkey. Its population is 338 (2022). Mahalle Archived 2013-03-31 at the Wayback Machine, Turkey Civil...

Changi City Point was bought by The Elegant Group[failed verification] for $338 million. List of shopping malls in Singapore Yahya, Yasmine (8 April 2014)...

Colman DR, Dhaunchak AS (2012). "Regulation of miRNA 219 and miRNA Clusters 338 and 17-92 in Oligodendrocytes". Frontiers in Genetics. 3: 46. doi:10.3389/fgene...

eastern terminus is north of Cotton City at the highway's junction with NM 338. NM 145 is also known as Goat Camp Road. NM 145 begins at the junction with...

California, Los Angeles). It was established in 1981. The h-index (1981-2021) is 338. The journal is abstracted and indexed in: AGRICOLA BIOSIS Previews Current...

Woodson, Robert Everard. 1928. Annals of the Missouri Botanical Garden 15: 338-339 Flora of China Vol. 19 Page 783 鬼臼属 gui jiu shu Dysosma Woodson Tropicos...

listings Tampa City Hall Historic American Buildings Survey (HABS) No. FL-338, "Tampa City Hall, 315 East Kennedy Boulevard, Tampa, Hillsborough County...

oscars.org. Retrieved July 31, 2011. Umland 2015, p. 274. Godfrey 2017, p. 338. "It is with great sadness that we share the news that Set Decorator Peter...

placed in charge of the royal "postal service," a high-ranking position. In 338 BC, Artaxerxes III met an abrupt end after being poisoned by the court eunuch...

2018. The weightlifter from India won the gold, with a combined lift of 338 kg. Prior to this competition, the existing world, Commonwealth and Games...

historical and cultural monuments of local significance by Decision No. 338 of the Cabinet of Azerbaijan dated November 3, 2021. The building was constructed...

Wal-Mart v. Dukes, 564 U.S. 338 (2011), was a United States Supreme Court case in which the Court ruled that a group of roughly 1.5 million women could...

village is populated by Kurds of the Surgucu tribe and had a population of 338 in 2021. Tizyan (today called Elmabahçe) was inhabited by 100 Syriacs in...

located in Logan County, Illinois. As of the 2020 census, its population was 338 and it contained 136 housing units. According to the 2010 census, the township...

York, Routledge (« Culture and Civilization in the Middle East »), 2012, 338 p. (ISBN 978-0-415-67292-4)". Arabica. 60 (5): 643–644. doi:10.1163/15700585-12341261...

elevated railroad track reconstructed into a linear park. The hotel, which has 338 guest rooms, was designed by the architects Ennead Architects (formerly Polshek...

Hibernici". Zeitschrift für celtische Philologie. 38 (1): 338–342. doi:10.1515/zcph.1981.38.1.338. Ó Cathasaigh, Tomás (2006–2007). "Review: A companion...

and district of Seyitgazi, Eskişehir Province, Turkey. Its population is 338 (2022). Kümbet village is 75 km (47 mi) far from Eskişehir, i 36 km (22 mi)...

radio y televisión, pp. 334-338. Source: Ayala, R. (1962) Musicosas: manual del comentarista de radio y televisión, pp. 338-341. (Translated from Spanish)...

"Crown shyness in a tropical cloud forest" (PDF). Biotropica (FTP). pp. 338–339. Bibcode:1988Biotr..20..338R. doi:10.2307/2388326. ISSN 0006-3606. JSTOR 2388326...

journals and diaries of her international travels. Armorial Families, p. 338 The Peerage and Baronetage of the British Empire as at Present Existing:...

Winchester introduced three such cartridges: the .264 Winchester Magnum, .338 Winchester Magnum and .458 Winchester Magnum, all based on the shortened...

official estimate (for 2019) is 24,001. The district covers a total area of 338 km2 (131 sq mi). The capital city of the District is named San Carlos as...

Sievierodonetsk Raion, Luhansk Oblast, Ukraine. In 2001, it had a population of 338. Until 2016, it was known as Chervona Dibrova (Ukrainian: Червона Діброва)...

sights with a 13.1 mil (45 MOA) built in vertical cant designed for their .338 Lapua Magnum rifles fitted with the 5–25×56 telescopic sight. Even with a...

Missionschefs in Deutschland und deutsche Missionschefs im Ausland von Metternich bis Adenauer. Walter de Gruyter. pp. 338–. ISBN 978-3-11-095684-9....

(Borboridae)". Bulletin de la Société Entomologique de France. 1917. Paris: 333–338. Retrieved 24 October 2017. Richards, O. W. (1963). "A new species of Leptocera...

Boniface. Gemmill, J A (1889). The Canadian Parliamentary companion. p. 338. Retrieved 2012-10-21. "Martin Jerome (1849-1936)". Memorable Manitobans...

receptors in the dorsal horn of pig spinal cord". Brain Res. 547 (2): 335–338. doi:10.1016/0006-8993(91)90982-2. PMID 1884211. S2CID 25052101. v t e...

Don: AeroCrafter - Homebuilt Aircraft Sourcebook, Fifth Edition, pages 338-339. BAI Communications, 15 July 1998. ISBN 0-9636409-4-1 All Aero (2015)...

România. Partea 1 (in Romanian). Bucharest: Ministerul Mediului. 1992. p. 338. OCLC 895459847. River code: X.1.25.10 Valea lui Coman (jud. Arges), e-calauza...

The Rural Municipality of Viscount No. 341 (2016 population: 338) is a rural municipality (RM) in the Canadian province of Saskatchewan within Census...

The Main road 338 is a short bypass direction Secondary class main road near Nyíregyháza, that connects the M3 motorway's Nyíregyháza-nyugat junction...

John (1989). "Soap bubbles make serious physics". Nature. 338 (6213): 293. Bibcode:1989Natur.338..293M. doi:10.1038/338293a0. Graner, François; Glazier,...

administrative centre), 96 km from Ivanovo (capital of Ivanovo Oblast) and 338 km from Moscow. Antropovo is the nearest rural locality. Деревня Патракейка...

strength-graded structural timber with rectangular cross-sections. The EN 338 standard defines strength classes for structural timber, facilitating the...

encoded by the TMEM8B gene. It encodes for a transmembrane protein that is 338 amino acids long, and is located on human chromosome 9. Aliases associated...

municipal seat is Buenavista de Cuéllar. The municipality covers an area of 338.1 km2. In 2005, the municipality had a total population of 12,148. "Buenavista...

50°20′17″N 4°33′25″W / 50.338°N 4.557°W / 50.338; -4.557 Windsor is a hamlet in Cornwall, England, United Kingdom. It is located half-a-mile east of...

The molecular formula C17H18F3N3O3 (molar mass: 369.338 g/mol) may refer to: Fleroxacin RU-58841 This set index page lists chemical structure articles...

village in the Kurucaşile District, Bartın Province, Turkey. Its population is 338 (2021). Köy Archived 2015-07-06 at the Wayback Machine, Turkey Civil Administration...

number of 134 houses and population of 735 of which include 397 males and 338 females. Literacy rate of Fazlabad is 83.21%, higher than state average of...

Province, 1954–1960". British Journal of Middle Eastern Studies. 42 (3): 320–338. doi:10.1080/13530194.2014.947242. Toby Matthiesen (2015). The Other Saudis...

Héllēnes), was a federation of Greek states created by Philip II of Macedon in 338–337 BC. The League was created in order to unify Greek military forces under...

Syrphidae) from the Andes Mountains". ZooKeys (338): 55–65. Bibcode:2013ZooK..338...55M. doi:10.3897/zookeys.338.6093. PMC 11331625. PMID 39161640. Retrieved...

supply 200 CSR 338 sniper rifles to CRPF". The Hindu. 2025-09-23. ISSN 0971-751X. Retrieved 2025-09-25. "Icomm-Caracal to supply 200 CSR 338 sniper rifles...

instrumental there. Macedonia would rise in power at the Battle of Chaeronea in 338 BC, bringing decisive victory to Philip II over an alliance of Thebes and...

amongst 6 other high schools. As of 2023-2024 Pleasant Valley High School had 338 students enrolled in grades 7-12. The Raiders compete in the Alabama High...

Industrial Chemistry, Weinheim, Germany: Wiley-VCH Verlag & Co. KGaA, p. 338, doi:10.1002/14356007.a08_565, ISBN 978-3-527-30385-4{{citation}}: CS1 maint:...

Chapitre XIV §.9 « Kambodge » Listes et tableau généalogique n°34 p. 337-338. Peter Truhart, Regents of Nations, K.G Saur Münich, 1984-1988 ISBN 3-598-10491-X...

chapitre XIV §.9 « Kambodge » Listes et tableau généalogique n°34 p. 337-338. Peter Truhart, Regents of Nations, K.G Saur Münich, 1984-1988 ISBN 359810491X...

Raymond A. Schroth (2002). Fordham: A History and Memoir. Loyola Press. pp. 338–339. ISBN 978-0-8294-1676-3. Linda De Roche (2011). Mary Higgins Clark: Life...

(1990). Toponymie générale de la France (in French). Librairie Droz. p. 338. ISBN 2600028838. Retrieved 8 December 2021. Wikimedia Commons has media...

(a selo) in Vysokogorsky District, Tatarstan, Russia. The population was 338 as of 2010. Insya is located 17 kilometres (11 mi) north of Vysokaya Gora...

Ohio. Boje, D. M. (2008). Storytelling organizations, London: Sage Page 338 Twotrees, K. (2000). Seven directions practice: A practice for the crossroads...

Kimball Laundry Co. v. United States, 338 U.S. 1 (1949), affirmed the principle set forth in The West River Bridge Company v. Dix et al., 47 U.S. 507...

eldest son of Archidamus III, and the 21st Eurypontid king of Sparta between 338 and 331 BC. He tried to lead a revolt against Macedonian hegemony over Greece...

municipality and district of Nallıhan, Ankara Province, Turkey. Its population is 338 (2022). Mahalle, Turkey Civil Administration Departments Inventory. Retrieved...

158 east of Notrees. The route intersects Loop 338 and Spur 450 in West Odessa and then follows Loop 338 along the west side of Odessa until SH 302 terminates...

Xiào Gōng; 381–338 BC), personal name Ying Quliang, was a duke of the state of Qin during the Eastern Zhou dynasty, reigning from 361 to 338 BC. Duke Xiao...

available in three cartridges: .308 Winchester, .300 Winchester Magnum and .338 Lapua. It was introduced at the 2000 SHOT Show. The AR-30 features a 5-round...

Rifle APC308 - 7.62mm Battle Rifle APR308/338 - bolt-action rifle, available either .308 Winchester or .338 Lapua Magnum SPR300 - integrally-suppressed...

Lady Ren may refer to: Empress Ren (fl. 315–338), wife of Cheng Han's founding emperor Li Xiong Ren Neiming (865–918), wife of Min's founder Wang Shenzhi...

60 km/37.28 miles away from the main district city of Bijapur, and 545 km/338.95 miles from the state capital, Bangalore. The nearest major railway station...

states 1844. *Girolamo Baruffaldi (1844). Vite de' pittori e scultori ferraresi: con annotazioni, Volume 2. Domenico Taddei, Ferrara. pp. 338–306. v t e...

America Provide Insight into Wing Origins". Science. 338 (6106): 510–514. Bibcode:2012Sci...338..510Z. doi:10.1126/science.1225376. ISSN 0036-8075. JSTOR 41703797...

common .338" sized bullets of the older .33 Winchester, led to the creation of the popular Wildcat cartridge the .338-06, also known as the 338 OKH, and...

firing .338-calibre very-low-drag bullets up to 16.85 g (260 gr). Longer, heavier very-low-drag bullets like the Sierra HPBT MatchKing .338-calibre 19...

.458 Winchester Magnum (1956): .458 in (11.6 mm) bullet .338 Winchester Magnum (1958): .338 in (8.6 mm) bullet .264 Winchester Magnum (1959): .264 in...

Fontanals, escenógrafo: teatro, cine y exilio. Editorial Fundamentos. p. 338. ISBN 9788424511104. Noble, Andrea (2005). Mexican National Cinema. Psychology...

Therapy of Atopic Dermatitis. Clin Rev Allergy Immunol. 2021 Dec;61(3):324-338". "NIAID, New discovery leads to novel probiotic for eczema, Press Release...

Attraction | How to Reach". Travel News India. 7 August 2016. Retrieved 12 March 2017. 23°24′04″N 85°20′17″E / 23.401°N 85.338°E / 23.401; 85.338 v t e...

built by Hyundai Heavy Industries. It is a fully cellular container ship at 338 m in length and 46 m beam, with a capacity of 9,012 TEU including 854 refrigerated...

Jennifer A. (2019). Words on Fire. Scholastic Publishing. pp. 4–10. ISBN 978-1-338-27578-0. admin (2021-06-08). "Words on Fire". Retrieved 2025-09-13. "Words...

municipality and district of Germencik, Aydın Province, Turkey. Its population is 338 (2022). Mahalle Archived 2023-03-06 at the Wayback Machine, Turkey Civil...

German Names. Translated by Gentry, Edda. University of Wisconsin-Madison. p. 338. This page lists people with the surname Liepert. If an internal link intending...

long-range anti-materiel and sniper rifle. It also produces the McMillan Tac-338, McMillan Tac-300 and McMillan Tac-308 sniper rifles, the ALIAS Rifle System...

of the World Online. Retrieved 8 May 2024. Hutchinson, John; Dalziel, J. M. (1928). "Tropical African Plants II". Kew Bulletin. <not stated>: 335–338....

România. Partea 1 (in Romanian). Bucharest: Ministerul Mediului. 1992. p. 338. OCLC 895459847. River code: X.1.25.6 Rausorul (de Rucar) (jud. Arges), e-calauza...

PGM Hécate II (12.7×99mm NATO / .50 BMG), .416 Barrett/10.6×83mm PGM 338 (.338 Lapua Magnum / 8.6×70mm) PGM Ultima Ratio (7.62×51mm NATO as main military...

the British Isles to 1660" (PDF). Journal of Meteorology. 24 (243): 326–338. ISSN 1748-2992. Retrieved 12 February 2022. "British & European Extremes"...

Heritage List for England, retrieved 6 November 2023 Historic England, "338, Trowell Road, Nottingham (1255225)", National Heritage List for England...

icm.edu.pl/cejsh/element/bwmeta1.element.ojs-doi-10_17951_sb_2014_8_21/c/338-338.pdf "Гісторык: Апошнія беларусы, якія абаранялі Польшчу, здаліся немцам...

62 m at the village of Nisovo. Its drainage basin covers a territory of 338 km2 or 21.1% of the Beli Lom's total. The Malki Lom has a rain–snow feed...

sniper rifles are chambered for specialized ammunition, such as .338 Lapua Magnum or .338 Norma Magnum, that they do not share with common weapons. In the...

Barrett MSG Loads by Lutz Möller (including images) Lapua product brochure .338 Lapua Magnum ammunition Archived 2007-09-27 at the Wayback Machine. VihtaVuori...

King Fahad and is managed the Ministry of Water and Electricity. At 103 m (338 ft) in height, it was the tallest dam in the country until the 106 m (348 ft)...

Combs did set a new world land-speed record for a woman, at 522.783 mph (841.338 km/h). Since the crash, the project has been abandoned. The vehicle was based...

There are currently 338 stations on the Seoul Subway network operated by Seoul Metro, Seoul Metro Line 9 Corporation and other operators. The first section...

administrative centre), 112 km from Ivanovo (capital of Ivanovo Oblast) and 338 km from Moscow. Markovo is the nearest rural locality. Деревня Солодихино...

Province, 1954–1960". British Journal of Middle Eastern Studies. 42 (3): 320–338. "وتسقط ورقة التوت..!". Al Sharq. 4 July 2017. Archived from the original...

son Constantius II. He served two terms as governor of Egypt (335–37 and 338–40), and finally as governor of Pontus in northern Anatolia. During his term...

Province, 1954–1960". British Journal of Middle Eastern Studies. 42 (3): 320–338. doi:10.1080/13530194.2014.947242. Toby Matthiesen (2015). The Other Saudis...

Western Australian arid zone". Journal of Arachnology. 46 (2): 249–344 [338]. doi:10.1636/JoA-S-17-057.1. Retrieved 2023-08-07. "Species Bungulla westi...

age of 55. Gemmill, J A (1889). The Canadian Parliamentary companion. p. 338. Retrieved 2012-10-19. "John Hettle (1842-1897)". Memorable Manitobans. Manitoba...

systematics of Diapterus (Perciformes, Gerreidae). Zoologica Scripta, 43 (4): 338–350. Gaudant, Jean; Carnevale, Giorgio (2015). "Pharisatichthys aquensis...

in (RBI). He scored 997 Major League runs, and he accumulated 1,878 hits, 338 doubles, and 35 triples, while playing in 1,866 regular-season games. Williams...

in Livingston County, Illinois. As of the 2020 census, its population was 338 and it contained 141 housing units. According to the 2021 census gazetteer...

rifle chambered for a large caliber Magnum round such as .300 Win Mag and .338 Lapua Magnum. The solicitation was placed on January 15, 2009. The contract...

western part of the island. Its highest point on the island is the 103-metre (338 ft) tall Litløytinden. From the Middle Ages until the 20th century, the island...

The Moths of America North of Mexico Including Greenland, fasc. 15.5. Washington, D.C.: The Wedge Entomological Research Foundation. pp. 1–338. v t e...

ISBN 978-3-8329-5609-7 Bosnia and Herzegovina 2000 Legislative Election Archived 2010-06-10 at the Wayback Machine Election Results Archive Nohlen & Stöver, pp337–338...

in the Çankırı District of Çankırı Province in Turkey. Its population is 338 (2021). Köy Archived 6 March 2023 at the Wayback Machine, Turkey Civil Administration...

Global Silk Industry: A Complete Source Book. Universal-Publishers. p. 338. ISBN 978-1-58112-493-4. Cole, George S. (1900). Cole's Encyclopedia of Dry...

historical and cultural monuments of local significance by Decision No. 338 of the Cabinet of Azerbaijan dated November 3, 2021. Zulfuqarov's madrasa...

village is populated by Kurds of the Bekiran tribe and had a population of 338 in 2021. The hamlet of Bulutlu is attached to the village. "Türkiye Mülki...

Bosporus and Dardanelles straits is 110 meters (360 ft) and 103 meters (338 ft), respectively, which would put them above the ocean levels in the Last...

118 ft) summit in Banff National Park, Alberta, Canada. With only 103 m (338 ft) prominence, Bident Mountain together with Quadra Mountain form an imposing...

 88–89. Blue Book of the State of Illinois. Office of the Illinois Secretary of State. 1919. p. 338. Retrieved February 16, 2023 – via Google Books....

terminus of the route is at KY 338 in Rabbit Hash. The eastern terminus is at KY 1017 in Florence. It begins at KY 338 (East Bend Road) in the small hamlet...

dubrovački pjesnik XVIII stoljeća (1706-1771)". Rad - Philology Section (in Croatian) (338 / Book 13). Yugoslav Academy of Sciences and Arts: 147–258. v t e...

1853 to recognize places from a region by a range of numbers. From number 338, assigned on 1 October 1854 to the post office in Lehesten, the numbers are...

7 mi) long and 1.3 kilometres (0.8 mi) wide and lies at an elevation of 338 metres (1,109 ft) about 12 kilometres (7 mi) northeast of the community of...

(2009-09-28). The Eponym Dictionary of Mammals. Baltimore: The Johns Hopkins University Press. p. 338. ISBN 978-0-8018-9304-9. OCLC 270129903. v t e...

(consul), Praetorian prefect of the East of Constantine I, from 329 to 337/338 Ablabius (historian) (floruit 4th/5th century), writer of a history of the...

Models chambered in the magnum cartridges .338 Lapua Magnum, .300 Win Mag, and .300 PRC went on sale in 2018. .338 Lapua Magnum with 1:9.375 RH twist, 26...

annual shareholders report says the company has controlling interests in 338 venues globally and believes itself to be "the largest live entertainment...

introduced the new M98B. The M98B was a bolt-action rifle chambered in .338 Lapua Magnum, which went on sale in 2009. On February 26, 2016, Tennessee...

Timotheus of Heraclea (Ancient Greek: Τιμόθεος ὁ Ἡρακλειεύς, Timotheos; died 338 BC) was son of Clearchus, the tyrant of Heraclea on the Euxine (Black Sea)...

tornado as F3 on the Fujita Scale. However, the stated wind estimate of 338 to 418 km/h (210 to 260 mph) would rank it at F4 intensity. According to...

and Calulu, Etymologically and Sociogastronomically". Callaloo. 30 (1): 338–342. doi:10.1353/cal.2007.0136. ISSN 1080-6512. Hamilton, Russell G; Hamilton...

1970–1992 (illustrated ed.). St Ives, N.S.W.: Australian Chart Book. p. 338. ISBN 0-646-11917-6. "Don Williams Chart History (Hot Country Songs)". Billboard...

Virudhunagar district in the South Indian State of Tamil Nadu. It is located 545km (338.647 Mile) southwest of state capital Chennai and 89km (55.302Mile) south...

1920–1964. New York: Metropolitan Museum of Art. pp. 82–83. ISBN 978-0-87099-338-1. "Criminal Law (Consolidation) (Scotland) Act 1995". legislation.gov.uk...

incorporated into the Republic following the break-up of the Latin League in 338 BCE. It became the standard Romanization policy for incorporating conquered...

runs from south to north from Rivière-Beaudette at the junction of Route 338 (just south of Autoroute 20) to Rigaud at the junction of Route 342. Rivière-Beaudette...

township in Watonwan County, Minnesota, United States. The population was 338 at the 2000 census. Riverdale Township was organized in 1869, and named after...

the Grammy Hall of Fame. Rolling Stone magazine ranked the album number 338 in its 2003 list of the "500 Greatest Albums of All Time". It was repositioned...

Surrender of Germany. Stroud, Gloucestershire: Spellmount. ISBN 978-1-86227-338-2. Scarfe, Norman (1983). Cambridgeshire (A Shell Guide). Faber and Faber...

Airport covers an area of 146 acres (59 ha) at an elevation of 1,110 feet (338 m) above mean sea level. It has one runway designated 8/26 with a turf and...

municipality and district of İmamoğlu, Adana Province, Turkey. Its population is 338 (2022). Mahalle Archived 2023-03-06 at the Wayback Machine, Turkey Civil...

November 16, 2022. Willems, M. (2019). The pigeon HAS to go to school! : an animated film. Danbury, CT: Weston Woods Studios. ISBN 978-1-338-57263-6. v t e...

vs. Claws. Scholastic Inc. ISBN 978-1-338-24581-3. Quinn, Spencer (October 6, 2020). Bark vs. Snark. Scholastic Press. ISBN 978-1-338-24583-7. v t e...

green 478 grey Fourth pressing: 1,014 copies 338 half translucent green/half white 338 translucent dark blue 338 black/light blue/light pink tri-color Fifth...

zircons proposed to originate from the basin suggesting a precise age of 4.338 billion years. It was named for two features on opposite sides of the basin:...

to the species of the M. lepidura group (Characiformes: Characidae)". Zootaxa. 4107 (3): 338–352. doi:10.11646/zootaxa.4107.3.3. PMID 27394824. v t e...

Multilingual Empire," p. 34 (PDF p. 36/338). Strauss, "A Constitution for a Multilingual Empire," p. 50 (PDF p. 52/338). Strauss, "A Constitution for a Multilingual...

was the last prince of the Xianbei-led Dai dynasty of China and ruled from 338 to 376 when Dai was conquered by the Former Qin dynasty. He was the son of...

said it "has grandly reestablished the old "Aldwych" tradition." Wearing p.338 The Illustrated London News, Volume 211. Illustrated London News & Sketch...

New Mexico State Road 47 (NM 47) is a 60.338-mile-long (97.105 km) state highway in Bernalillo, Valencia, and Socorro Counties in New Mexico. NM 47's...

J. C. Clarke Publishing Company: Chicago, Illinois, Biographical Sketch of David Meade Woodson, p. 338 David M. Woodson at Find a Grave v t e v t e...

Major Three Species. VENUS (The Japanese Journals of Malacology). 43(4）：331ー338. Adams, A. (1861). On some new species of Mollusca from the north of China...

large-scale model of the functioning brain". Science. 338 (6111): 1202–5. Bibcode:2012Sci...338.1202E. doi:10.1126/science.1225266. Spaun version 2.0...

and finished 10–4, but did not make the playoffs. Passing: Ken Anderson (338 Att, 179 Comp, 2367 Yds, 53.0 Pct, 19 TD, 14 Int, 76.9 Rating) Rushing: Boobie...

of Ovariotomy". Surgeon-Major A. J. Willcocks, Prince of Wales' Hospital, Benares in The Indian Gazette. November 1887.p. 338–339. PMID 28999804 v t e...

609 lb⋅ft (826 N⋅m) of torque at 3700 rpm, allowing for a top speed of 210 mph (338 km/h). Customers pay for the base 997 Turbo, which costs $122,900 USD, then...

low energy ion back scattering and LEED". Surface Science. 338 (1): 1–10. Bibcode:1995SurSc.338....1M. doi:10.1016/0039-6028(95)00565-X. ISSN 0039-6028....

times and station information for Westgate-on-Sea railway station from National Rail 51°22′52″N 1°20′17″E / 51.381°N 1.338°E / 51.381; 1.338 v t e...

America Provide Insight into Wing Origins". Science. 338 (6106): 510–514. Bibcode:2012Sci...338..510Z. doi:10.1126/science.1225376. PMID 23112330. S2CID 2057698...

Калта́н) is a town in Kemerovo Oblast, Russia, located on the Kondoma River, 338 kilometers (210 mi) south of Kemerovo, the administrative center of the oblast...

a politician of the Roman Empire, twice praefectus urbi of Rome (in 337–338 and in 351–352) and once consul (in 340). He was a vir clarissimus, the lowest...

Thai section of the Salween River. It was founded in 1978 and is 875 km2 (338 sq mi) in size. IUCN (1990). "Thailand". 1990 United Nations list of national...

Brest Region, Belarus. It is part of Aharodniki selsoviet. It is located 338 kilometres (210 mi) south-west of the capital Minsk and near the border with...

in history at 338.17 mph at the NHRA Midwest Nationals. Force won the 2022 NHRA Top Fuel championship and reset the speed record to 338.94 mph. She also...

Magna Graecia, at the time when Timoleon landed in Sicily 344 BC until 338 BC. He was regarded by Plutarch as a warlike and wealthy man. After the defeat...

imitator, Walker). Agricultural Gazette of New South Wales Misc. Pub. 2: 338, 362-363 "Bibio imitator Walker, 1835". www.gbif.org. Retrieved 2023-12-22...

Case studies from Southeast Asia" [C. R. Biologies 338 (2015) 351–361]". Comptes Rendus Biologies. 338 (10): 708. doi:10.1016/j.crvi.2015.06.001. ISSN 1631-0691...

Fagaropsis and Luvunga in Rutaceae". Taiwania. 54 (4). doi:10.6165/tai.2009.54(4).338. Appelhans, Marc S.; Wen, Jun (2020). "Phylogenetic placement of Ivodea and...

State Highway 325 (SH 325) is a 11.395-mile (18.338 km) state highway in Garfield County, Colorado, United States, that connects Colorado State Highway...

in 1979 and based in Speke, England. As of October 2025, the company has 338 stores in Britain and primarily sells frozen food, but has a wide range of...

network for underground communication. The secret Order was named for the 338 BCE battle where the Sacred Band of Thebes was ultimately defeated. In the...

as a midfielder, and current football manager. He played 13 seasons and 338 games in the Primeira Liga for Gil Vicente and Belenenses. He made his Primeira...

is in the collection of Stourhead, in Wiltshire. Bailey p.182 Ingamells p.338 Cordingly p.15 Wallace Collection Art UK National Trust Collections Bailey...

[2024] EWCA Crim 808 R v Drake [2023] EWCA Crim 1454 R v Wu [2023] EWCA Crim 338 R v Keal [2023] EWCA Crim 1454 R v Smith [2020] EWCA Crim 38 R v Melin [2019]...

Zhao and Former Yan against the Duan-Liaoxi duchy from January to April 338. The campaign ended in victory for the alliance and destruction of the Duan...

libraries Quinlin's Estate is his second novel; according to WorldCat, it is in 338 libraries. WorldCat book entry WorldCat book entry Portals: Biography United...

after the Security Council was informed of the apparent failure of UNSCR 338 and UNSCR 339 to end the fighting. In UNSCR 340, the Council demanded that...

creek reaches its mouth at the Moira River at an elevation of 103 metres (338 ft), about 1.1 kilometres (0.7 mi) west of the community of Thrasher's Corners...

half leased blocks: Eugene Island 313, 314 south, 330, 331, 332, 337 and 338. In the outer continental shelf lease sale on December 15, 1970 240,361 hectares...

; Webb, T.J. (2006). "Cd11/18". Encyclopedia of Respiratory Medicine. pp. 338–343. doi:10.1016/B0-12-370879-6/00062-4. ISBN 978-0-12-370879-3. v t e...

light machine gun, Galil assault rifle, Tavor assault rifle, and the DAN .338 sniper rifle. IWI develops and manufactures guns used by armies and law enforcement...

Charles Clarke: Crumbs from a Sportsman's Table. Chapman & Hall, 1869; S. 336–338 Littell's The Living Age, plate 74, Living Age Company Incorporated, Boston...

is this the origin of large-scale motions?". Nature. 338 (6216): 562–564. Bibcode:1989Natur.338..562S. doi:10.1038/338562a0. ISSN 1476-4687. S2CID 4336689...

Ivica Osim ( Japan) (66 years, 62 days) Youngest: Graham Arnold (42 years, 338 days) "Đội tuyển Việt Nam chuẩn bị cho Asian Cup 2007: Luồng gió trẻ". Archived...

king of the state of Qin during the Eastern Zhou dynasty, reigning from 338 to 311 BC. He was the first ruler of Qin to style himself "King" (王) instead...

243 Winchester, .308 Winchester, .300 Winchester Magnum) and 27.2 inch (.338 Lapua Magnum) lengths. Feed is from detachable double-column box magazines...

Sixteen Kingdoms. The tribe was conquered by the Murong-led Former Yan in 338, but remained politically influential as maternal relatives of the Murong...

Honduras, with the Description of Three New Species". Herpetologica. 73 (4): 338–348. (Tantilla gottei, new species). Murillo, Emmanuel Orellana; Antúnez-Fonseca...

parasitic on Brassicaceae and related hosts". Nova Hedwigia. 74 (3–4). Schweizerbart Science Publishers: 291–338. doi:10.1127/0029-5035/2002/0074-0291. v t e...

selo) in Leninsky District, Jewish Autonomous Oblast, Russia. Population: 338 (2010 census); 373 (2002 census); There are 6 streets in this selo. This...

warns against quarrels of which others will take advantage. It is numbered 338 in the Perry Index. The fable only existed in Greek sources formerly and...

The Maserati 3200 GT (Tipo 338) is a four-seater grand tourer produced by Italian automobile manufacturer Maserati from 1998 to 2002, replacing the Shamal...

99 m (325 ft) level. The calculated Height Above Average Terrain is 103 m (338 ft). "Facility Technical Data for KILJ-FM". Licensing and Management System...

time. He left as the school's all-time winningest coach with a record of 338–195. After his retirement as a basketball coach, Covington became an assistant...

7mm Remington Magnum is based on the commercial .264 Winchester Magnum, .338 Winchester Magnum, and .458 Winchester Magnum, which were based on the same...